ID: 951111876

View in Genome Browser
Species Human (GRCh38)
Location 3:18813281-18813303
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111867_951111876 17 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data
951111869_951111876 2 Left 951111869 3:18813256-18813278 CCAAATCATCATGGCCAAATCCA No data
Right 951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data
951111865_951111876 30 Left 951111865 3:18813228-18813250 CCACATGAAGGGACCACGTAGAG No data
Right 951111876 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type