ID: 951111878

View in Genome Browser
Species Human (GRCh38)
Location 3:18813294-18813316
Sequence ACATGTAGGGCAGCCCTCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951111871_951111878 1 Left 951111871 3:18813270-18813292 CCAAATCCAGCCCTAAGGCTCCA No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data
951111873_951111878 -9 Left 951111873 3:18813280-18813302 CCCTAAGGCTCCAGACATGTAGG No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data
951111869_951111878 15 Left 951111869 3:18813256-18813278 CCAAATCATCATGGCCAAATCCA No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data
951111872_951111878 -5 Left 951111872 3:18813276-18813298 CCAGCCCTAAGGCTCCAGACATG No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data
951111875_951111878 -10 Left 951111875 3:18813281-18813303 CCTAAGGCTCCAGACATGTAGGG No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data
951111867_951111878 30 Left 951111867 3:18813241-18813263 CCACGTAGAGGACAACCAAATCA No data
Right 951111878 3:18813294-18813316 ACATGTAGGGCAGCCCTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951111878 Original CRISPR ACATGTAGGGCAGCCCTCTT CGG Intergenic