ID: 951114279

View in Genome Browser
Species Human (GRCh38)
Location 3:18841515-18841537
Sequence TATGGTTGTTAAGAAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951114279_951114282 6 Left 951114279 3:18841515-18841537 CCCATAGCTTCTTAACAACCATA No data
Right 951114282 3:18841544-18841566 AATTAACCCGATTTTACTGTTGG No data
951114279_951114283 7 Left 951114279 3:18841515-18841537 CCCATAGCTTCTTAACAACCATA No data
Right 951114283 3:18841545-18841567 ATTAACCCGATTTTACTGTTGGG No data
951114279_951114284 8 Left 951114279 3:18841515-18841537 CCCATAGCTTCTTAACAACCATA No data
Right 951114284 3:18841546-18841568 TTAACCCGATTTTACTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951114279 Original CRISPR TATGGTTGTTAAGAAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr