ID: 951116910

View in Genome Browser
Species Human (GRCh38)
Location 3:18874409-18874431
Sequence TAGCAGGAACTACACGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951116908_951116910 12 Left 951116908 3:18874374-18874396 CCAGTTTAGCATTATCTTTGTCA No data
Right 951116910 3:18874409-18874431 TAGCAGGAACTACACGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951116910 Original CRISPR TAGCAGGAACTACACGAAGA AGG Intergenic
No off target data available for this crispr