ID: 951118517

View in Genome Browser
Species Human (GRCh38)
Location 3:18894694-18894716
Sequence TTGAAAAGGCATGGAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951118513_951118517 5 Left 951118513 3:18894666-18894688 CCAAAGATGGCACAAATCAAATT No data
Right 951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG No data
951118511_951118517 21 Left 951118511 3:18894650-18894672 CCACTCACACAGCTTTCCAAAGA No data
Right 951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951118517 Original CRISPR TTGAAAAGGCATGGAGAGGA TGG Intergenic
No off target data available for this crispr