ID: 951120438

View in Genome Browser
Species Human (GRCh38)
Location 3:18920698-18920720
Sequence CTGTGTTTTCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951120438_951120446 18 Left 951120438 3:18920698-18920720 CCTTCCTCCTTCTGAAAACACAG No data
Right 951120446 3:18920739-18920761 CAGGAGGGGAGAAATGCTGTAGG No data
951120438_951120444 3 Left 951120438 3:18920698-18920720 CCTTCCTCCTTCTGAAAACACAG No data
Right 951120444 3:18920724-18920746 TCTTTGGCATCGTCTCAGGAGGG No data
951120438_951120443 2 Left 951120438 3:18920698-18920720 CCTTCCTCCTTCTGAAAACACAG No data
Right 951120443 3:18920723-18920745 GTCTTTGGCATCGTCTCAGGAGG No data
951120438_951120442 -1 Left 951120438 3:18920698-18920720 CCTTCCTCCTTCTGAAAACACAG No data
Right 951120442 3:18920720-18920742 GACGTCTTTGGCATCGTCTCAGG No data
951120438_951120445 4 Left 951120438 3:18920698-18920720 CCTTCCTCCTTCTGAAAACACAG No data
Right 951120445 3:18920725-18920747 CTTTGGCATCGTCTCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951120438 Original CRISPR CTGTGTTTTCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr