ID: 951123421

View in Genome Browser
Species Human (GRCh38)
Location 3:18956224-18956246
Sequence ACATATGAGATACAGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951123421_951123423 10 Left 951123421 3:18956224-18956246 CCACTCCACTGTATCTCATATGT No data
Right 951123423 3:18956257-18956279 CAATTTGCTATATTGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951123421 Original CRISPR ACATATGAGATACAGTGGAG TGG (reversed) Intergenic
No off target data available for this crispr