ID: 951123423

View in Genome Browser
Species Human (GRCh38)
Location 3:18956257-18956279
Sequence CAATTTGCTATATTGACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951123421_951123423 10 Left 951123421 3:18956224-18956246 CCACTCCACTGTATCTCATATGT No data
Right 951123423 3:18956257-18956279 CAATTTGCTATATTGACCCATGG No data
951123420_951123423 11 Left 951123420 3:18956223-18956245 CCCACTCCACTGTATCTCATATG No data
Right 951123423 3:18956257-18956279 CAATTTGCTATATTGACCCATGG No data
951123422_951123423 5 Left 951123422 3:18956229-18956251 CCACTGTATCTCATATGTGATCA No data
Right 951123423 3:18956257-18956279 CAATTTGCTATATTGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951123423 Original CRISPR CAATTTGCTATATTGACCCA TGG Intergenic
No off target data available for this crispr