ID: 951129822

View in Genome Browser
Species Human (GRCh38)
Location 3:19029372-19029394
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951129813_951129822 27 Left 951129813 3:19029322-19029344 CCCTGGCAGTGCTCCATGGCTTA No data
Right 951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG No data
951129817_951129822 14 Left 951129817 3:19029335-19029357 CCATGGCTTAGGGAGAAAGAGTC No data
Right 951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG No data
951129814_951129822 26 Left 951129814 3:19029323-19029345 CCTGGCAGTGCTCCATGGCTTAG No data
Right 951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG No data
951129812_951129822 28 Left 951129812 3:19029321-19029343 CCCCTGGCAGTGCTCCATGGCTT No data
Right 951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type