ID: 951130428

View in Genome Browser
Species Human (GRCh38)
Location 3:19036078-19036100
Sequence CCAAAGCAAAAATGGGCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5991
Summary {0: 2, 1: 41, 2: 552, 3: 1200, 4: 4196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951130423_951130428 -6 Left 951130423 3:19036061-19036083 CCCATAAGCACAGGCAACCAAAG 0: 43
1: 496
2: 902
3: 1041
4: 1146
Right 951130428 3:19036078-19036100 CCAAAGCAAAAATGGGCAATTGG 0: 2
1: 41
2: 552
3: 1200
4: 4196
951130422_951130428 -5 Left 951130422 3:19036060-19036082 CCCCATAAGCACAGGCAACCAAA 0: 37
1: 502
2: 1202
3: 1623
4: 1993
Right 951130428 3:19036078-19036100 CCAAAGCAAAAATGGGCAATTGG 0: 2
1: 41
2: 552
3: 1200
4: 4196
951130424_951130428 -7 Left 951130424 3:19036062-19036084 CCATAAGCACAGGCAACCAAAGC 0: 43
1: 488
2: 1023
3: 1871
4: 14762
Right 951130428 3:19036078-19036100 CCAAAGCAAAAATGGGCAATTGG 0: 2
1: 41
2: 552
3: 1200
4: 4196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951130428 Original CRISPR CCAAAGCAAAAATGGGCAAT TGG Intergenic
Too many off-targets to display for this crispr