ID: 951131002

View in Genome Browser
Species Human (GRCh38)
Location 3:19044952-19044974
Sequence TCTCACCTGGAGATCGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951130998_951131002 21 Left 951130998 3:19044908-19044930 CCTGCATAGTTGGAATTTGTCAG No data
Right 951131002 3:19044952-19044974 TCTCACCTGGAGATCGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951131002 Original CRISPR TCTCACCTGGAGATCGTGCA TGG Intergenic
No off target data available for this crispr