ID: 951137087

View in Genome Browser
Species Human (GRCh38)
Location 3:19117333-19117355
Sequence CTGCTAGGTTTGAGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951137087_951137091 11 Left 951137087 3:19117333-19117355 CCTGTTTTTCTCAAACCTAGCAG No data
Right 951137091 3:19117367-19117389 TTCAAGGCAACAAATACCTGAGG No data
951137087_951137090 -5 Left 951137087 3:19117333-19117355 CCTGTTTTTCTCAAACCTAGCAG No data
Right 951137090 3:19117351-19117373 AGCAGATAGCTGAGGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951137087 Original CRISPR CTGCTAGGTTTGAGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr