ID: 951140015

View in Genome Browser
Species Human (GRCh38)
Location 3:19148130-19148152
Sequence CACGGGACTCCAGTCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951140001_951140015 14 Left 951140001 3:19148093-19148115 CCCCGACCTGTCTCCTCCCTTTC 0: 1
1: 0
2: 2
3: 45
4: 428
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140000_951140015 18 Left 951140000 3:19148089-19148111 CCTGCCCCGACCTGTCTCCTCCC 0: 1
1: 1
2: 4
3: 75
4: 704
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140007_951140015 -3 Left 951140007 3:19148110-19148132 CCTTTCTCCAATACCACACCCAC 0: 1
1: 0
2: 6
3: 36
4: 354
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140010_951140015 -10 Left 951140010 3:19148117-19148139 CCAATACCACACCCACGGGACTC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951139999_951140015 25 Left 951139999 3:19148082-19148104 CCGGATACCTGCCCCGACCTGTC 0: 1
1: 0
2: 0
3: 8
4: 151
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140002_951140015 13 Left 951140002 3:19148094-19148116 CCCGACCTGTCTCCTCCCTTTCT 0: 1
1: 1
2: 5
3: 68
4: 810
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140005_951140015 1 Left 951140005 3:19148106-19148128 CCTCCCTTTCTCCAATACCACAC 0: 1
1: 0
2: 4
3: 17
4: 344
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140003_951140015 12 Left 951140003 3:19148095-19148117 CCGACCTGTCTCCTCCCTTTCTC 0: 1
1: 0
2: 11
3: 154
4: 1371
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140006_951140015 -2 Left 951140006 3:19148109-19148131 CCCTTTCTCCAATACCACACCCA 0: 1
1: 0
2: 4
3: 43
4: 463
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168
951140004_951140015 8 Left 951140004 3:19148099-19148121 CCTGTCTCCTCCCTTTCTCCAAT 0: 1
1: 0
2: 7
3: 65
4: 645
Right 951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951140015 Original CRISPR CACGGGACTCCAGTCTCCCC GGG Intergenic
900091840 1:924131-924153 CGCGGGACTCCAGACGCCCCGGG + Intergenic
900318837 1:2072599-2072621 CACGGGCCCCCAGTCGCCCCAGG - Intronic
900626508 1:3611071-3611093 CACGGGCCTCCAGAGGCCCCGGG + Intronic
901308010 1:8247304-8247326 AAAAGGACTCCAGTTTCCCCAGG + Intergenic
901505372 1:9681874-9681896 GAAGGGACTGCAGTCTCCCCGGG + Intronic
901758931 1:11458259-11458281 CACTGCACTCCAGTCTCCATTGG + Intergenic
901988194 1:13092240-13092262 CCAGGGACACCAGTATCCCCAGG + Intergenic
901993618 1:13134527-13134549 CCAGGGACACCAGTATCCCCAGG - Intergenic
903022439 1:20403741-20403763 CTCTGGACCTCAGTCTCCCCAGG + Intergenic
906763741 1:48407230-48407252 GCCAGGACTCCAGTCTCCCTTGG + Intronic
908520716 1:64938873-64938895 CACGGGTCTCTATCCTCCCCTGG + Intronic
912154447 1:106900203-106900225 CATGATACTCCAGTCTACCCTGG + Intergenic
915218138 1:154353380-154353402 CAGGAGAGTCCAGCCTCCCCAGG - Intergenic
915558109 1:156671016-156671038 CCCAGGCCTCCAGGCTCCCCAGG - Exonic
915622457 1:157094138-157094160 CAAGGGCCTCCAGTCTAGCCGGG + Intronic
920541876 1:206784948-206784970 CACGGGAATCCAGGATCCCATGG - Intergenic
922881007 1:228980534-228980556 CACGGGATTCCAGTCTCCTGTGG + Intergenic
923429234 1:233904976-233904998 CAGCGCACTCCAGTCTTCCCAGG + Exonic
1065362724 10:24904544-24904566 CACGGGGCTGAAGTGTCCCCAGG - Intronic
1066210667 10:33234323-33234345 CACGGGCCACCAGTCTTCTCTGG - Intronic
1067406145 10:46025209-46025231 AACAGAACTCCAGGCTCCCCAGG - Intronic
1069416062 10:68201896-68201918 CGCGGCACTCCAGTCTCACGGGG - Exonic
1069723154 10:70562173-70562195 CATGGGACTCATGTCTCCCAGGG + Intronic
1069738839 10:70674703-70674725 CACGACACTCCAGTCACCTCCGG + Exonic
1070803655 10:79257715-79257737 CACTGGACACCTGGCTCCCCAGG - Intronic
1076454453 10:130580089-130580111 CACTTGACTGCAGGCTCCCCTGG - Intergenic
1077185841 11:1234976-1234998 CACGGGGCCTCAGCCTCCCCAGG - Intronic
1077446036 11:2591338-2591360 CACTGGGCACCAGGCTCCCCAGG + Intronic
1077560102 11:3254964-3254986 CACAAGACTGCTGTCTCCCCTGG - Intergenic
1077565995 11:3300767-3300789 CACAAGACTGCTGTCTCCCCTGG - Intergenic
1078830701 11:14974006-14974028 CACGGAACTCCAGGTACCCCGGG + Intronic
1080749550 11:35139455-35139477 CACTTGACTCCAGTCCCCCAGGG - Intronic
1081963457 11:47155037-47155059 CCTGGGCCGCCAGTCTCCCCTGG - Intronic
1083722465 11:64610174-64610196 CACCCGACTCCAATCTCCCCTGG + Intronic
1085405165 11:76257319-76257341 CTCGGGGCTCCAGGATCCCCTGG - Intergenic
1085512540 11:77095644-77095666 GGCCTGACTCCAGTCTCCCCAGG + Intronic
1086092900 11:83021606-83021628 CGCCTGACTCCAGTCTCCCTTGG + Intronic
1087515559 11:99154905-99154927 CCAGGGACTCCAGTCTCCCAAGG - Intronic
1089049775 11:115536187-115536209 CCCTGGCCTCCAGTCTCCTCAGG + Intergenic
1089785885 11:120906850-120906872 CTCTGGACTCCAGTCACCCTGGG - Intronic
1090224613 11:125062742-125062764 CACAGGACCCCACTCTTCCCCGG - Intergenic
1093281942 12:17204994-17205016 CACCTGACTCCAGTCTTCCTTGG + Intergenic
1094836365 12:34324013-34324035 CCAGGGACTCCAGGATCCCCGGG + Intergenic
1094840005 12:34338900-34338922 CCCGGTACCCCAGTGTCCCCAGG - Intergenic
1094841602 12:34344727-34344749 CCCGGGACCCCAGGGTCCCCGGG + Intergenic
1097661451 12:62435570-62435592 CACGGGACTGCACCCTGCCCTGG + Intergenic
1102583868 12:113909676-113909698 CACAGTACTCCAGAGTCCCCCGG - Intronic
1102631741 12:114286983-114287005 AACTTGACTCCAGTCTCCCTGGG - Intergenic
1102678810 12:114676267-114676289 CACTGGACTCCAGTCCCTCGTGG - Intronic
1103891060 12:124239481-124239503 CAGGGGACTCCAGGCATCCCGGG + Intronic
1107065896 13:36214306-36214328 GACGCGAGTCCACTCTCCCCCGG - Intronic
1108081002 13:46735833-46735855 CACTGCACTCCAGTCTGGCCAGG - Intronic
1109909016 13:68885868-68885890 CAAGGAACTTCACTCTCCCCAGG + Intergenic
1110213989 13:73005815-73005837 GAAGGGACTCCAGCCACCCCAGG + Intronic
1111665904 13:91267445-91267467 CATGGGACTCCAATTTCCTCAGG + Intergenic
1113956606 13:114102808-114102830 CACAGGACTCCAGCCTCCACAGG - Intronic
1114556977 14:23567720-23567742 CCCAGGACTCCAGCCTCACCTGG + Exonic
1114616009 14:24068836-24068858 CAGGGGCCGCCAGCCTCCCCAGG + Exonic
1114704075 14:24707952-24707974 CATGGTGCTCCTGTCTCCCCTGG - Intergenic
1118641570 14:67797700-67797722 CACGTCACCCCAGTCTCCGCCGG - Exonic
1118767581 14:68920576-68920598 TTCGGGACTTCAGTCTTCCCAGG + Intronic
1120805018 14:88737480-88737502 CACTGGGCTCCAGGCTCGCCAGG - Intronic
1122691269 14:103533132-103533154 GAGGGGACTCCAGACTCCTCCGG - Intronic
1123113206 14:105882493-105882515 CATGGGAATCCAGAATCCCCAGG - Intergenic
1123115556 14:105892644-105892666 CATGGGAATCCGGTATCCCCAGG - Intergenic
1123119802 14:105911361-105911383 CATGGGAATCCAGAATCCCCAGG - Intergenic
1202898520 14_GL000194v1_random:23208-23230 CCAGGGACGCCAGTGTCCCCAGG + Intergenic
1124504509 15:30261547-30261569 GCAGGGACTCCCGTCTCCCCAGG + Intergenic
1124604041 15:31157679-31157701 CAAGGGTCCCCAGTGTCCCCAGG + Intronic
1124739042 15:32277088-32277110 GCAGGGACTCCCGTCTCCCCAGG - Intergenic
1125745081 15:41992414-41992436 CACTGCTCTCCAGTCTTCCCCGG + Intronic
1132572550 16:650313-650335 CACGTGGCTCCAGTTTCCCTTGG + Exonic
1133311274 16:4848034-4848056 CGCGGCACACCAGGCTCCCCTGG + Intronic
1133317094 16:4891700-4891722 CACCAGCATCCAGTCTCCCCAGG - Intronic
1134466641 16:14484626-14484648 CAAGGGACTCCAGTTTACCAGGG + Intronic
1136172051 16:28495509-28495531 CATGGGACTCCTGCCTCTCCTGG - Exonic
1136276327 16:29181252-29181274 CGTGGGACTCCAGTCTCCCTGGG - Intergenic
1137055755 16:35746072-35746094 CTCTGGCCCCCAGTCTCCCCAGG - Intergenic
1137272004 16:46908148-46908170 CACAGGACTGCAGGCTCCACCGG - Intronic
1137671820 16:50283713-50283735 CCTGGGACTGCAGTCTCCTCAGG + Intronic
1139563265 16:67757167-67757189 CATTGCACTCCAGTCTCACCAGG + Intronic
1141266951 16:82506416-82506438 CACGGAACATCAGACTCCCCTGG + Intergenic
1141771821 16:86094197-86094219 TTCTGGACTCCAGTCTCTCCAGG - Intergenic
1141929753 16:87194257-87194279 CAGGGGTCCCCAGTCCCCCCAGG - Intronic
1142080711 16:88147312-88147334 CGTGGGACTCCAGTCTCCCTGGG - Intergenic
1142238859 16:88936011-88936033 CAGGGGGCTGCAGTCACCCCTGG + Intronic
1146460518 17:33042613-33042635 CTCTGGGCTCCAGTCTCACCAGG - Intronic
1146822059 17:35991488-35991510 CCTGGGACTCAAGTATCCCCAGG - Intronic
1147328023 17:39679277-39679299 CACTGGACTGCAGGCTACCCTGG + Intronic
1147951846 17:44111837-44111859 CAGGGGACACCTGTCTGCCCAGG - Intronic
1147953559 17:44120253-44120275 CAAGGGACACCTGACTCCCCAGG - Intronic
1147989820 17:44325740-44325762 CATGGCTCTCCCGTCTCCCCCGG - Intergenic
1149431166 17:56596290-56596312 CACTGGCCTCCCCTCTCCCCGGG + Intergenic
1152409675 17:80117131-80117153 CTCTGGTCTCCCGTCTCCCCAGG - Intergenic
1157316537 18:46594466-46594488 CACTGTGCTCCACTCTCCCCAGG - Intronic
1157523506 18:48361649-48361671 CAAGGGATTCCAGTGTGCCCTGG - Intronic
1159059516 18:63500104-63500126 CACTGCACTCCAGCCTGCCCAGG - Intronic
1162915019 19:13869983-13870005 CACGGGCCGCCAGACACCCCTGG + Intronic
1163493161 19:17629165-17629187 CCCAGGACTCCCTTCTCCCCAGG - Intronic
1166212095 19:41313320-41313342 CACGGGCCTCCAGACTCCTCAGG - Intronic
1167344702 19:48937919-48937941 CACGGAGCTTCCGTCTCCCCTGG + Intronic
1167474353 19:49691370-49691392 CACAGGACTCCAGGCCCCGCCGG - Intronic
1167486733 19:49767213-49767235 CCCGCGTCTCCAGTGTCCCCCGG - Intronic
1167621420 19:50563117-50563139 CAGGGGACTGCTGTTTCCCCAGG - Intronic
927266763 2:21161229-21161251 CATCTGACTCCAGTCTCCCTTGG - Intergenic
927852838 2:26510832-26510854 CACGGGCCTGCACGCTCCCCGGG + Intronic
929885614 2:45875066-45875088 CAGGTGCCTCCAGTCTCCACAGG + Intronic
932779999 2:74553966-74553988 GAGGGGGGTCCAGTCTCCCCTGG - Intronic
935783906 2:106531872-106531894 CCCAGCATTCCAGTCTCCCCAGG + Intergenic
937216925 2:120318775-120318797 CAAGGGCCTCCAGTCGGCCCTGG - Intergenic
942228383 2:173836811-173836833 CTCGGAGCTCCAGTCCCCCCTGG + Intergenic
944217489 2:197270661-197270683 CAAGGGCCTCCAGTCTCACTAGG + Intronic
948437101 2:237961232-237961254 CACGGGAGTTCAGCATCCCCTGG + Intergenic
949025363 2:241765255-241765277 CCCGGGGCTCCCATCTCCCCAGG - Intronic
949046948 2:241876713-241876735 CCCTGGACTCCAGTTTCTCCTGG - Intergenic
1168798731 20:630206-630228 CACGGTGCTCCAGTCACTCCAGG + Intergenic
1172884056 20:38219665-38219687 CACGGAGCTCCAGCTTCCCCAGG + Exonic
1172976892 20:38912906-38912928 CACTGCACTCCAGTCTAGCCTGG - Intronic
1173672784 20:44810017-44810039 CACGGGACCCCAGGGTCTCCAGG - Intronic
1175310912 20:58011081-58011103 CAGGGGATTCTAGGCTCCCCAGG - Intergenic
1175899159 20:62353279-62353301 CATGGGAATCCAGGCGCCCCTGG - Intronic
1176062886 20:63179941-63179963 CACGGTCCACCAGTCTCCTCAGG + Intergenic
1176618202 21:9039198-9039220 CCAGGGACGCCAGTGTCCCCAGG + Intergenic
1178589649 21:33898588-33898610 CCCAGGAGTCCAGCCTCCCCTGG + Exonic
1179576990 21:42313934-42313956 CAAGGGACCCCAGATTCCCCAGG - Intronic
1179879400 21:44287159-44287181 CCAGGGTCTCCAGTCTTCCCGGG + Intronic
1179991149 21:44948857-44948879 CGCCTGACTCCAGTCTCCCTTGG - Intronic
1180098695 21:45574327-45574349 CTCCGGACTCCATTCTTCCCAGG + Intergenic
1181288265 22:21770539-21770561 CACGGTACTCCAGCCTGGCCTGG + Intronic
1183348120 22:37319074-37319096 CTCCGTGCTCCAGTCTCCCCAGG - Intergenic
1183952714 22:41360594-41360616 CATGTGACTTCAGTCTCCCTTGG - Intergenic
1185041203 22:48505300-48505322 CAGGGCACTCCAGACGCCCCCGG - Intronic
949573028 3:5311701-5311723 CAGGCGACTCCAGTTCCCCCAGG - Intergenic
949981015 3:9501672-9501694 CAGGTGCCACCAGTCTCCCCTGG - Exonic
950498400 3:13348199-13348221 CATGGGAGTCAAGTTTCCCCAGG - Intronic
951140015 3:19148130-19148152 CACGGGACTCCAGTCTCCCCGGG + Intergenic
956560090 3:70565522-70565544 CACGGGACTCCAAGTTCCTCCGG + Intergenic
957850952 3:85806800-85806822 CACTAGACTCCTATCTCCCCGGG - Intronic
961026225 3:123560425-123560447 CCCAGGCCTCCAATCTCCCCAGG + Intronic
961642452 3:128373235-128373257 CACGGAACTCCACACTCCACTGG - Intronic
968119347 3:196113725-196113747 CACAGTACTCCGGTCTCCACTGG + Intergenic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
972023896 4:34352436-34352458 CACTGCACTCCAGCCTTCCCAGG - Intergenic
972490263 4:39580563-39580585 CACTGTACTCCAGCCTCGCCTGG - Intronic
972523358 4:39883677-39883699 CACGGCACTTCACTCTCTCCTGG - Intronic
991570683 5:68050271-68050293 CACGGGATTCCAGATTGCCCAGG + Intergenic
993193876 5:84715306-84715328 CACAGGACTGCAGTCTCCAAGGG - Intergenic
999738954 5:154534660-154534682 CGCGGGTCCCCAGCCTCCCCTGG - Intergenic
1001547836 5:172581468-172581490 CAAGGAACTCCAGTCTCCCAAGG + Intergenic
1006211935 6:32403159-32403181 AGCTGGACTCCACTCTCCCCAGG + Exonic
1013348738 6:109287367-109287389 CCCCAGACTCCAGTCTCCTCTGG - Intergenic
1014949985 6:127542897-127542919 CACGGGCCATCAGTCTCCTCTGG + Intronic
1017065789 6:150527894-150527916 CAGGGGGCTCCAGGCTTCCCTGG + Intergenic
1017072725 6:150590123-150590145 CAAAGGACTCCAGTCTACACAGG + Intergenic
1017751737 6:157495027-157495049 CATGGGACTACAGCCTCCCATGG + Intronic
1019431791 7:1002768-1002790 CACAGGACTCCACTCACCCAAGG - Intronic
1019431825 7:1002887-1002909 CACAGGACTCCACTCACCCAAGG - Intronic
1019432000 7:1003522-1003544 CACAGGACTCCACTCACCCAAGG - Intronic
1019432073 7:1003777-1003799 CACAGGACTCCACTCACCCAAGG - Intronic
1020069689 7:5218252-5218274 CACGGCACTTCTGTCTCCTCTGG - Intronic
1023483386 7:40658919-40658941 CACACCACTCCAGTTTCCCCGGG - Intronic
1027625077 7:80534375-80534397 CACTGCACTCCAGTCTAGCCTGG + Intronic
1029257791 7:99281040-99281062 CTCGGGGCTCCAGTCTCCAATGG - Intergenic
1030903940 7:115159721-115159743 CTGGGGACTCCAGTCTGCTCTGG - Intergenic
1034494655 7:151412215-151412237 CACGGGACTCCAGGCCCTCTTGG - Intergenic
1035372356 7:158387531-158387553 CCCTGGAGTCCAGTCCCCCCAGG - Intronic
1037931177 8:22881170-22881192 CACAGGGCTCCAGTGTCCCCAGG + Intronic
1038153740 8:24967106-24967128 GAAGGACCTCCAGTCTCCCCAGG - Intergenic
1041561479 8:59224193-59224215 CACTGCACTCCAGTCTGGCCAGG + Intergenic
1041690867 8:60685539-60685561 CTCGGGGCTGCAGTCTCCCTCGG + Intronic
1049747048 8:144267378-144267400 CAGGGGACTCCACACTCCACTGG - Intronic
1049784153 8:144442636-144442658 CAAGGGACTCCACTCCCTCCTGG + Intronic
1050437773 9:5628642-5628664 CACGTGACTCCAGCTCCCCCCGG + Intergenic
1054350412 9:64014357-64014379 CCAGGGACGCCAGTGTCCCCAGG + Intergenic
1055471321 9:76614142-76614164 CACAGGTCTCAACTCTCCCCAGG - Exonic
1056040472 9:82660449-82660471 CACGGGTCTCAAGGCTCCACTGG + Intergenic
1057770194 9:97960650-97960672 CATGGCACTCCAGCCTCCCGAGG - Intergenic
1059321889 9:113476493-113476515 GACCAGACTCCAGGCTCCCCAGG - Intronic
1062096548 9:134706776-134706798 CAGGGGACTCCAGGGTCCTCAGG - Intronic
1203698223 Un_GL000214v1:115913-115935 CCAGGGATTCCAGGCTCCCCGGG - Intergenic
1201151591 Y:11098035-11098057 CCAGGGACGCCAGTGTCCCCAGG + Intergenic