ID: 951140218

View in Genome Browser
Species Human (GRCh38)
Location 3:19149048-19149070
Sequence CCCACAGTGAATACGGGCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951140218_951140224 2 Left 951140218 3:19149048-19149070 CCGACGCCCGTATTCACTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 951140224 3:19149073-19149095 CTGCATTTTGGTGTATCTTTAGG 0: 1
1: 0
2: 1
3: 20
4: 275
951140218_951140222 -10 Left 951140218 3:19149048-19149070 CCGACGCCCGTATTCACTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 951140222 3:19149061-19149083 TCACTGTGGGACCTGCATTTTGG 0: 1
1: 0
2: 2
3: 12
4: 149
951140218_951140227 25 Left 951140218 3:19149048-19149070 CCGACGCCCGTATTCACTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 951140227 3:19149096-19149118 GAATTGGTTGTAATTTTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 271
951140218_951140225 3 Left 951140218 3:19149048-19149070 CCGACGCCCGTATTCACTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 951140225 3:19149074-19149096 TGCATTTTGGTGTATCTTTAGGG 0: 1
1: 0
2: 0
3: 32
4: 290
951140218_951140226 9 Left 951140218 3:19149048-19149070 CCGACGCCCGTATTCACTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 34
Right 951140226 3:19149080-19149102 TTGGTGTATCTTTAGGGAATTGG 0: 1
1: 0
2: 0
3: 8
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951140218 Original CRISPR CCCACAGTGAATACGGGCGT CGG (reversed) Intronic
904074742 1:27831349-27831371 GCCACAGAGAATACGAGGGTAGG + Intronic
911157968 1:94655209-94655231 ACCACACTGAATACAGGGGTGGG - Intergenic
921954263 1:220965849-220965871 CCCAAGGAGAATACGGGCGCTGG + Intergenic
1063003545 10:1946657-1946679 CTCACAGTGAATACTGGCTTTGG + Intergenic
1063267781 10:4473591-4473613 CCCATAGTGGATGCGGGCATGGG + Intergenic
1067794682 10:49312205-49312227 CCCACTGTGAATATGTGCATGGG - Intronic
1080596860 11:33780792-33780814 CACACAGTGATTACAGGCTTTGG + Intergenic
1081686798 11:45048654-45048676 CCCACAGTGAACAATGGCGGGGG - Intergenic
1083896250 11:65621219-65621241 CCCACAGTGAACAGGGGCCATGG + Intronic
1087967515 11:104436085-104436107 CCAACACTGAATACCGGAGTGGG + Intergenic
1103737548 12:123070201-123070223 CCCACAGTGGACATGGGCTTAGG - Intronic
1125715639 15:41818433-41818455 CCAACAGTGGACACGGGGGTTGG - Intronic
1129363317 15:75038255-75038277 CCCACAATGTCCACGGGCGTGGG - Intronic
1131509486 15:93041817-93041839 CCCAGAGAGAACACGGGAGTTGG - Intronic
1133068053 16:3224222-3224244 CCCACAGTGATTACAGTCATAGG + Exonic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1151157708 17:72138228-72138250 CCCACAGTGCAATGGGGCGTGGG - Intergenic
1152915163 17:83030841-83030863 TCCCCAGTGAAGACGGGAGTCGG + Intronic
1154941416 18:21116249-21116271 CCCACACTGAATCCGGGCTGGGG + Intergenic
1165329077 19:35131472-35131494 CCCACCGTGAATGCCAGCGTGGG - Exonic
926067001 2:9849597-9849619 CCCACAATGAATACAGACATAGG - Intronic
930566458 2:53026810-53026832 CCCACATTAAATACGGTCATAGG + Intergenic
940464844 2:154014371-154014393 CCCCCAGTGAATACTGGGGAAGG - Intronic
942149078 2:173056922-173056944 CCCCCAGAGAATAAGGGCGTGGG + Intergenic
945812679 2:214567764-214567786 CACACAGTTAATAAGTGCGTGGG - Intronic
1181386264 22:22548124-22548146 CCCACAGTGAGGACAGGGGTTGG + Exonic
1181844217 22:25693622-25693644 CCAACAGTGAAAATGGGCGTTGG - Intronic
1185353325 22:50349856-50349878 CCCAAACTGATTACAGGCGTGGG - Intronic
950531849 3:13556769-13556791 CCCACAGTGACTTCGGAAGTTGG + Intronic
951140218 3:19149048-19149070 CCCACAGTGAATACGGGCGTCGG - Intronic
974783487 4:66585819-66585841 CCCACAGGGAATTCTGGAGTTGG - Intergenic
985721662 5:1492825-1492847 CCCAGAGTGAATCTGAGCGTTGG - Intronic
995873418 5:116765685-116765707 CCTACAGTGCATACAGGCTTTGG - Intergenic
1017824520 6:158071615-158071637 GACACAGTGAAGACGGGCATGGG + Exonic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034964719 7:155384032-155384054 CCCCCAGAGAAGGCGGGCGTGGG - Intronic
1039196416 8:35036484-35036506 CCCACATAGAATAGGGGCTTAGG - Intergenic
1041463090 8:58132904-58132926 CCCAAAGTGAAAAAGGGAGTTGG - Intronic
1051229231 9:14937010-14937032 CCCATAGAGAATACAGGCTTAGG + Intergenic