ID: 951140648

View in Genome Browser
Species Human (GRCh38)
Location 3:19154524-19154546
Sequence GTAGATGCCAACTTTAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951140645_951140648 11 Left 951140645 3:19154490-19154512 CCTTCCCATGTTCTACAGTCTAA 0: 1
1: 0
2: 0
3: 12
4: 148
Right 951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG 0: 1
1: 0
2: 0
3: 4
4: 90
951140646_951140648 7 Left 951140646 3:19154494-19154516 CCCATGTTCTACAGTCTAAAGCA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG 0: 1
1: 0
2: 0
3: 4
4: 90
951140644_951140648 24 Left 951140644 3:19154477-19154499 CCAAAATGCTCAACCTTCCCATG 0: 1
1: 0
2: 0
3: 9
4: 141
Right 951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG 0: 1
1: 0
2: 0
3: 4
4: 90
951140647_951140648 6 Left 951140647 3:19154495-19154517 CCATGTTCTACAGTCTAAAGCAC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG 0: 1
1: 0
2: 0
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951140648 Original CRISPR GTAGATGCCAACTTTAGACT TGG Intronic
906161166 1:43650134-43650156 GCAGATGCCGACTTTAGAGGAGG + Intergenic
908754246 1:67453536-67453558 GCACATGCCAACTTCAGAGTTGG - Intergenic
916980753 1:170134362-170134384 GGAAATGCCAACTTTAGGCAAGG - Intergenic
918569005 1:185965259-185965281 GTAAATGCAAATTTTAGGCTTGG + Intronic
1065234938 10:23639664-23639686 GGAGATGCCAGCATTAGGCTGGG + Intergenic
1065495480 10:26323081-26323103 GGAGATTCCAACTTAAGCCTGGG + Intergenic
1066356449 10:34688892-34688914 GAAGATGCAAATTTTATACTTGG - Intronic
1068875297 10:61989428-61989450 GTAGATGTCCACTTAAAACTGGG - Intronic
1069591938 10:69647574-69647596 GCATATGCCTACTTTAGGCTAGG + Intergenic
1073498131 10:103912537-103912559 GCAGAAGCAAACTTTAAACTAGG + Intronic
1074218222 10:111409178-111409200 GCAGATGCCAACTTTATGCCTGG + Intergenic
1076799970 10:132816684-132816706 GTAAATGCCAACGTCAGAATAGG - Intronic
1081578981 11:44339089-44339111 GTGGGTGCCTTCTTTAGACTGGG + Intergenic
1083230946 11:61318901-61318923 TTAGGTCCCAACTTTAGGCTAGG + Intronic
1087509161 11:99068201-99068223 GTAGATGCCTACTTTATTCTAGG + Intronic
1090492017 11:127172953-127172975 GTAGATGACTACTTTAGATTTGG + Intergenic
1090695332 11:129235424-129235446 GATGATGACAATTTTAGACTAGG - Intronic
1096127421 12:49130230-49130252 CCAGAAGCCCACTTTAGACTAGG + Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1098355934 12:69612577-69612599 TTAGATGTCACCTCTAGACTTGG + Intergenic
1099133931 12:78869580-78869602 GTAGATGCCATTTTAAAACTAGG - Intronic
1101559308 12:105840920-105840942 GTAGATGTCAGCTTCAGAGTGGG - Intergenic
1102676583 12:114663695-114663717 GTAGATGCCTACTTTGTTCTAGG + Intergenic
1103494183 12:121348788-121348810 ATATATGCCAACTTTAGATGTGG + Intronic
1109058748 13:57585418-57585440 ATAAATTCCAACTTTAAACTGGG + Intergenic
1112246227 13:97736535-97736557 GCAGAAGATAACTTTAGACTTGG + Intergenic
1118195791 14:63624525-63624547 GAAAATGCCAACTACAGACTGGG + Intronic
1119877465 14:78073045-78073067 GCAGAGGCCATCTTTAGACAGGG - Intergenic
1120066906 14:80052848-80052870 GTAGATGCCAACTTCTTGCTGGG - Intergenic
1127496111 15:59513605-59513627 ATATATGCCAACATTAAACTAGG - Intronic
1128951410 15:71887144-71887166 ATAGGTGCCAGCTTTGGACTTGG - Intronic
1130680000 15:85988356-85988378 GAAGATGTCAACTTTAAACCAGG - Intergenic
1131648538 15:94373712-94373734 GTCTATGCCAACGTTAGACGTGG + Intronic
1131741205 15:95394519-95394541 ACAGATGCCAATTTTAGAGTTGG - Intergenic
1138056603 16:53840800-53840822 GTAGCTGCCCATTTTAGACAAGG - Intronic
1140354034 16:74288932-74288954 AGAGATGCCACCTTTAGCCTAGG - Intergenic
1164905371 19:31963165-31963187 GAAGATGATAACTTTTGACTTGG - Intergenic
1165788316 19:38475536-38475558 GTAGCTGCCCACCTTACACTGGG + Intronic
928180862 2:29067356-29067378 CCAGATGCCAACTTTATACCTGG + Intronic
929800194 2:45093177-45093199 GTGGATGACTGCTTTAGACTGGG + Intergenic
935508401 2:103937461-103937483 GTGCATGCCATCTTTAGAATAGG + Intergenic
939912222 2:147996582-147996604 TTGGATGCCAATTTTAAACTGGG - Intronic
940475493 2:154157196-154157218 GTAGATGCCATGGTGAGACTAGG - Intronic
941179936 2:162247276-162247298 GTAGATGCCAATTACAAACTAGG - Intergenic
944057235 2:195535610-195535632 GTATATGCCATGTTTAAACTAGG - Intergenic
946234939 2:218318303-218318325 GCAGAGGCAAACTTTAGCCTTGG + Intronic
1169427927 20:5510716-5510738 CTTGATGGCAACATTAGACTGGG - Intergenic
1172676802 20:36678204-36678226 GAAAATGCAAACTATAGACTAGG + Intronic
1174182501 20:48683626-48683648 GTGGCTGCCAGCTTTAGACACGG - Intronic
1182021461 22:27085212-27085234 GTAGATGCCAAGGTTAGGGTGGG + Intergenic
951140648 3:19154524-19154546 GTAGATGCCAACTTTAGACTTGG + Intronic
956406102 3:68931065-68931087 GTAGCTGCCACCTGCAGACTCGG - Intronic
970382466 4:15521894-15521916 GTAATTGCCAACTTTTGATTTGG - Intronic
975354104 4:73380066-73380088 GTAGATCCCAACTTAGAACTAGG + Intergenic
981767988 4:148273981-148274003 GTAGAAGCCAGCTTCACACTAGG + Intronic
981784730 4:148464309-148464331 GTAGAAGGCAACTCTTGACTGGG - Intergenic
983637737 4:169915068-169915090 CTGAATGCCAAATTTAGACTTGG - Intergenic
984053050 4:174891118-174891140 GTAGATGTCAACTATAGTATGGG + Intronic
987464040 5:18251402-18251424 ATAGATGCCATCTGTAAACTAGG + Intergenic
987557041 5:19465926-19465948 GGGGATGCTAACTTAAGACTTGG + Intergenic
990030980 5:51259055-51259077 GTAGATGCAAATTTTGGGCTTGG - Intergenic
994326945 5:98459160-98459182 GTAGTTGGCAACTTTAGATGAGG - Intergenic
997672680 5:135689250-135689272 GTAGATTCCCTCTTAAGACTTGG - Intergenic
1000151383 5:158504820-158504842 GTAGATTCCAACTTCAAAGTTGG + Intergenic
1003121060 6:3319286-3319308 GCAGAAGCCAACTTTTGCCTTGG + Intronic
1003210491 6:4059938-4059960 GTTGATGCCAACTCTGGGCTGGG - Intronic
1004924943 6:20407191-20407213 GTTGATGCCAAGTTTAAGCTGGG + Intronic
1007728317 6:43930282-43930304 GTAGATGCCTACTTTGTACCTGG + Intergenic
1010634071 6:78234895-78234917 GGAGATCACAACTCTAGACTAGG - Intergenic
1010664470 6:78612301-78612323 TTAGATGGCAACTGTAGATTGGG - Intergenic
1011233148 6:85186722-85186744 GAAGATGTCAACATTAGAGTGGG - Intergenic
1013082920 6:106828349-106828371 ATAGATGCCACCTTGACACTGGG - Intergenic
1014078162 6:117261429-117261451 GTACATGTCAACTTTAGCTTTGG - Intergenic
1016287080 6:142485588-142485610 AAAGATGCCAAGTTTAGAATTGG + Intergenic
1020342112 7:7123269-7123291 GGAAATGCCAACTTTATTCTAGG - Intergenic
1025395398 7:59451770-59451792 TTAGATGCCAACTGTAGAAAGGG + Intergenic
1025650246 7:63460010-63460032 GTTAATGCTAACTTAAGACTTGG + Intergenic
1026310560 7:69180235-69180257 GTAGATGGCAAATGTAGTCTGGG - Intergenic
1028418328 7:90604308-90604330 GTAGCTGCCAACTTTGTACCTGG + Intronic
1029008423 7:97233406-97233428 GGGGATGCCATCTTGAGACTGGG - Intergenic
1033038224 7:137894791-137894813 GCAAGAGCCAACTTTAGACTTGG - Intronic
1033964640 7:146959902-146959924 AGGGATTCCAACTTTAGACTAGG + Intronic
1040982740 8:53261333-53261355 GTAGACTCCAACTTTATACAAGG + Intergenic
1042553963 8:70018885-70018907 GCAGATGTCAACTTTAAAGTGGG + Intergenic
1055268765 9:74531328-74531350 CAAGATGCCACCTTCAGACTAGG + Intronic
1058251860 9:102707937-102707959 GATGATGCCAAATTTAAACTAGG - Intergenic
1061715500 9:132516077-132516099 GGAGCTGCCAACTTTAGACCAGG - Intronic
1188411395 X:29876267-29876289 GTATATGCCAACCTCAGAGTGGG + Intronic
1188672696 X:32899145-32899167 GCAGTTGCCCATTTTAGACTGGG + Intronic
1189555148 X:42135646-42135668 GTAGATGAAAACTTTAAAATAGG + Intergenic
1191899551 X:66026736-66026758 ACAGATGCCTACTGTAGACTTGG + Intronic
1192607758 X:72537289-72537311 TTAGATGGCAACTTTGGAATAGG - Intronic
1193918042 X:87391103-87391125 GTAAATGCCATCTTTAGAATCGG - Intergenic
1199506080 X:148562984-148563006 GAAGAGGCCGACTTTAGCCTTGG + Intronic
1202082826 Y:21102329-21102351 GTAGATGCTAACTAGAGATTGGG + Intergenic