ID: 951141744

View in Genome Browser
Species Human (GRCh38)
Location 3:19170009-19170031
Sequence ATGTTCCCATTTGAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951141743_951141744 3 Left 951141743 3:19169983-19170005 CCAACTAGTTTGGGAAGGAATCA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 951141744 3:19170009-19170031 ATGTTCCCATTTGAGATCTGTGG 0: 1
1: 0
2: 5
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951141744 Original CRISPR ATGTTCCCATTTGAGATCTG TGG Intronic
900791267 1:4682497-4682519 ATGTCCCCATCTGTGCTCTGTGG + Intronic
902840905 1:19073314-19073336 ATATTCCCATTTGACAGGTGAGG + Intergenic
903134688 1:21301929-21301951 CTGTTCCCATTTGACAGATGAGG + Intronic
903459847 1:23513198-23513220 GTGTCCCCATTTGAGAGATGTGG + Intronic
905338357 1:37260730-37260752 CTGTTCCCATTTGGGAGATGAGG - Intergenic
905787152 1:40767421-40767443 ATTTTCCCAAATGAGATCTTTGG - Intronic
906290854 1:44618450-44618472 ACTTTTCCATTTGAGATCAGAGG + Intronic
907240869 1:53080335-53080357 CTCTGCCCATTTGAGATCTTTGG + Intronic
907271268 1:53292731-53292753 ATGTACTCATTTGACATATGAGG + Intronic
908025833 1:59950765-59950787 ACGGTCTCATTTGACATCTGAGG + Intergenic
910601559 1:89038160-89038182 ATGTTCCAATTTGTGATCTGAGG - Intergenic
912565565 1:110585003-110585025 ATGGTCCCATTTTAGATCTGGGG + Intergenic
912800465 1:112716663-112716685 TTGTCCCCATTTGAGATGTGTGG - Intergenic
915660365 1:157400309-157400331 ATGTTTGCATTGGAGATGTGGGG + Intergenic
916665834 1:166966675-166966697 ATGAACTCATTTCAGATCTGTGG - Intronic
917545851 1:175966938-175966960 AAATCCCAATTTGAGATCTGGGG + Intronic
917593351 1:176500204-176500226 ATGTTCCAATTTCAGAGATGTGG - Intronic
920559116 1:206926282-206926304 ATATTCCTATTGGAGTTCTGAGG + Intergenic
923087499 1:230712740-230712762 TTGTTCTCAGTTGTGATCTGCGG + Intronic
923496794 1:234532763-234532785 CTGTTCCCATTTTAGAAGTGAGG + Intergenic
923760345 1:236836907-236836929 ATGATCCCATTTTAGAGATGAGG - Intronic
924509007 1:244712853-244712875 ATGTCCCCATGTGAGGTTTGTGG - Intergenic
1063877565 10:10496087-10496109 ATGTCCCCATTTGACAGCTAAGG + Intergenic
1065990110 10:31000719-31000741 ATGTTACAATTTAAAATCTGGGG + Intronic
1068437164 10:57007519-57007541 ATTTTCCAATCTGAGATATGAGG + Intergenic
1069843978 10:71358059-71358081 ATTTTCTCACTTGAGAGCTGGGG + Intronic
1069910137 10:71753948-71753970 TTGGTCCCATTTTAGAGCTGGGG + Intronic
1071194942 10:83147715-83147737 AGTTTCACATTTGACATCTGGGG - Intergenic
1072225685 10:93366759-93366781 GTGTTCTCATCTGAAATCTGAGG + Intronic
1073755989 10:106580953-106580975 ATATTCCCATTTCAAAACTGAGG - Intronic
1073810190 10:107144044-107144066 CTGTTCCCTTTTGTGCTCTGAGG + Intronic
1075933495 10:126319913-126319935 ATCTGCCCATTAGAGATTTGGGG - Intronic
1076134990 10:128039685-128039707 ATGGACCCATTTCAGAACTGAGG - Intronic
1078266752 11:9760560-9760582 CTGGTTCCACTTGAGATCTGGGG + Intergenic
1079489715 11:20973888-20973910 AAGTTCCCATTAGAGTTTTGAGG - Intronic
1079572415 11:21960619-21960641 ATGTTCCCATTTCACAAGTGAGG + Intergenic
1081626383 11:44658402-44658424 TTGTTCCCATTTTATAACTGAGG - Intergenic
1083426439 11:62589917-62589939 ATATTTCCATTTTATATCTGAGG - Intronic
1084141002 11:67229178-67229200 ATGTTCCCATTTGTAAAATGAGG - Intronic
1085386505 11:76161117-76161139 ATGTCCACATATGAGAACTGAGG + Intergenic
1086267468 11:85018550-85018572 ACTTTCCCATGTGAGATCCGTGG - Intronic
1086329977 11:85744296-85744318 TTGTTCCCATTTTAAAACTGAGG + Intronic
1087508290 11:99056617-99056639 ATGTTCCCATCTGGGACCTAGGG - Intronic
1089157998 11:116416739-116416761 ATGTTCCCATTTGACAGATGTGG - Intergenic
1089387112 11:118075600-118075622 TTGTTCCCATTTGTCAGCTGAGG - Intergenic
1089607641 11:119650965-119650987 ATTTCCCCATTTGAGAGTTGGGG + Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090426507 11:126610539-126610561 ATGTTTGCATTGGAGGTCTGTGG + Intronic
1090629863 11:128636714-128636736 ATTCTCCTCTTTGAGATCTGGGG - Intergenic
1090996340 11:131869121-131869143 ATGTTCTCAATTGAGAGTTGAGG - Intronic
1092850022 12:12618377-12618399 ATGACCCCATCTGGGATCTGAGG - Intronic
1094214328 12:27924383-27924405 ATTATGCCATTTGAGAACTGAGG + Intergenic
1094522273 12:31204915-31204937 AAGTTCACTTTTGAGATCTGGGG - Intergenic
1094553480 12:31474402-31474424 AAGTGCCCATTTCTGATCTGGGG + Intronic
1095698490 12:45166306-45166328 ATGTGCACATGTGATATCTGTGG + Intergenic
1096066860 12:48747963-48747985 GAGTTCCCACTTGACATCTGTGG - Intergenic
1097160166 12:57040618-57040640 ATGTTCCCTTGTGAGCTCTCAGG - Intronic
1099113446 12:78592400-78592422 GTGTTCCCTTTTGAGCTCTCTGG + Intergenic
1101415680 12:104506359-104506381 TTGTTCCCATTTTAGATATGAGG - Intronic
1101442194 12:104712199-104712221 CTATTCCCATTTGACACCTGAGG + Intronic
1102183310 12:110929093-110929115 ATGTTCCCATTTCACATATGAGG - Intergenic
1103859893 12:124003866-124003888 CAGTGCCCATTTGAGATGTGTGG + Intronic
1103935650 12:124475114-124475136 CTGTTACCATGTGAGATGTGGGG + Intronic
1104021602 12:124995710-124995732 CTGTTCCCATTTGACAGATGAGG + Intronic
1104260504 12:127177781-127177803 ATTTTCCCATCTGAGCTGTGAGG + Intergenic
1112480094 13:99767254-99767276 ATCTTCATATTTGAGTTCTGAGG + Intronic
1114598923 14:23937939-23937961 ATATTCCCATTTTAGAAATGAGG - Intergenic
1118348016 14:64953834-64953856 ATGTTCCCATCTGAAAACTGTGG - Intronic
1118429448 14:65702039-65702061 TTGTTCCCATTTTATAGCTGAGG - Intronic
1118475173 14:66109699-66109721 ATGTTCCCCCTTGGGACCTGGGG - Intergenic
1120643327 14:87042057-87042079 ATGTTCAAATTTGAGGTTTGAGG - Intergenic
1123706035 15:22951683-22951705 CTGTTGCCATGTGGGATCTGTGG - Intronic
1124044848 15:26139274-26139296 ATGTTCACAGCTGAGAGCTGAGG - Intergenic
1125475579 15:40046029-40046051 ATCTTCCCATTTTACAGCTGAGG - Intergenic
1127965706 15:63921371-63921393 ATATTCCCAATTTAGAGCTGAGG - Intronic
1128291686 15:66483028-66483050 TTGTTCCCATTTTAGAGGTGAGG + Intronic
1131044599 15:89303724-89303746 ATATTACCACTTGAGATCTAAGG + Intronic
1131977322 15:97960155-97960177 ATATTTCCTTTTGAGATCTTGGG - Intergenic
1133799065 16:9070228-9070250 ATGTTCCCATTTGTTACGTGAGG + Intergenic
1133862310 16:9607574-9607596 ATGCTCCCATTTTGGAACTGAGG - Intergenic
1135876985 16:26211386-26211408 TTCTTTCCATTTGAAATCTGGGG - Intergenic
1136046866 16:27622119-27622141 CTGTACCCAGTGGAGATCTGAGG + Intronic
1136128213 16:28200803-28200825 ATGTTCCCATTTTATAGTTGAGG - Intronic
1136286622 16:29247995-29248017 ATGGTCCCATTTCACAGCTGAGG + Intergenic
1137530167 16:49274548-49274570 TTGTTCCCATTTGAAATGTGAGG + Intergenic
1138021010 16:53481388-53481410 ATATTCCCATTTTATATATGAGG - Intronic
1140195331 16:72850279-72850301 ATGTTTCCATGTGGGACCTGTGG - Intronic
1141230654 16:82164226-82164248 CTTTTCCCATTTTAGAACTGAGG + Intronic
1142092218 16:88220628-88220650 ATGGTCCCATTTCACAGCTGAGG + Intergenic
1143320898 17:6068408-6068430 ATGTGCCCATTTGACAGATGAGG - Intronic
1143993396 17:10986386-10986408 AAGTTCTCTTTGGAGATCTGAGG - Intergenic
1144374736 17:14627833-14627855 AGGTGACCATTTGAGATCAGAGG - Intergenic
1146741899 17:35292889-35292911 ATGTGGCCAGTTGGGATCTGAGG + Intergenic
1148209825 17:45801374-45801396 ATGCTCCCATTTTAAGTCTGGGG - Intronic
1148730383 17:49831624-49831646 ATTTTCCCATTTCTTATCTGGGG + Exonic
1150226247 17:63526105-63526127 AGGTTCCCTTCTGAGACCTGAGG - Intronic
1151989075 17:77562622-77562644 TCGTTCCCTTCTGAGATCTGAGG + Intergenic
1152257780 17:79250189-79250211 ATGTTCACATTTCACTTCTGAGG - Intronic
1154400586 18:14033213-14033235 ATGTCCCCATCTTAGTTCTGTGG + Intergenic
1154935732 18:21054462-21054484 AGGTCCCCACTTGAGAGCTGTGG - Intronic
1155985517 18:32226836-32226858 TTGTTCCCATTTTATAGCTGAGG - Intronic
1156062561 18:33098032-33098054 ATGCTACCCTTGGAGATCTGTGG + Intronic
1156222235 18:35064248-35064270 CTGGTCCCATTTGAGGTGTGTGG - Intronic
1156257837 18:35415066-35415088 ATGTTCCCACTTATGAACTGTGG - Intergenic
1156699223 18:39805054-39805076 ATGTTCCCATTTTAGAGATGGGG - Intergenic
1158709285 18:59823076-59823098 ATGAGCCAATTTCAGATCTGAGG - Intergenic
1164981833 19:32619934-32619956 CTGTTCCTACTTGAGACCTGTGG - Intronic
1167991060 19:53361015-53361037 CTGTTTCCATGTGACATCTGTGG - Intergenic
926743732 2:16133627-16133649 ATTTTACCATTTTACATCTGAGG - Intergenic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
929626470 2:43413792-43413814 ATGTATCCATTTAAGAACTGTGG - Intronic
930301821 2:49625928-49625950 ATTTTCCCATTGTAGAGCTGAGG - Intergenic
931779646 2:65567932-65567954 ATGTCACCATGTGAGAGCTGTGG - Intergenic
934950920 2:98574903-98574925 TTGTTCCCAGTAGAGATCTCAGG + Intronic
935289120 2:101594462-101594484 ATGTGCTCACTTCAGATCTGTGG - Intergenic
935549155 2:104433316-104433338 ATCTGCCCATTTAAGCTCTGAGG - Intergenic
935919615 2:107998394-107998416 ATGATCCCATTGGAAAACTGTGG + Intronic
937316709 2:120936209-120936231 ATGTCCCCATTTTAGAGATGGGG - Intronic
938771297 2:134503445-134503467 ATATTCCCATTTGAAAGATGAGG - Intronic
939023988 2:136990101-136990123 ATTTTCTCATTTAAGAACTGAGG + Intronic
939081279 2:137664622-137664644 ATCATCCCATTTGAGAGATGAGG + Intronic
941032923 2:160533448-160533470 ATTTTACCAGTTGAGAGCTGTGG + Intergenic
941140460 2:161774453-161774475 ATATTCCCCTTTGAGGACTGAGG + Intronic
943563820 2:189494511-189494533 AAATGCCCATTTGAGATATGTGG - Intergenic
946167284 2:217872097-217872119 GTGTTCCCATTTGATAGATGAGG - Intronic
946736521 2:222759362-222759384 ATTTTCCCATTTATTATCTGGGG + Intergenic
946847875 2:223876721-223876743 ATGTGACCGTTTGACATCTGTGG - Exonic
949070405 2:242020996-242021018 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070431 2:242021146-242021168 ATGTTCCCGTTTGAGGATTGGGG + Intergenic
949070438 2:242021174-242021196 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070515 2:242021561-242021583 ATGTTCCCGTTTGAGGATTGGGG + Intergenic
949070522 2:242021589-242021611 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070563 2:242021806-242021828 ATGTTCCCGTTTGAGGATTGGGG + Intergenic
949070570 2:242021834-242021856 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070593 2:242021957-242021979 ATGTTCCCGTTTGAGGGCTGGGG + Intergenic
949070619 2:242022080-242022102 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
949070718 2:242022519-242022541 ATGTTCCAGTTTGAGGGCTGGGG + Intergenic
1169027281 20:2381587-2381609 AAGTCCCCACTTGAGATGTGTGG - Intronic
1169365607 20:4989775-4989797 AGTTTCCCATTTTAGATTTGGGG + Intronic
1172639060 20:36430159-36430181 ATGTTCCCATTTTACAACAGGGG + Intronic
1173329295 20:42061003-42061025 TTATCCCCATTTGAAATCTGGGG - Intergenic
1174176246 20:48646879-48646901 ATGATCCCATTTTACATATGAGG - Intronic
1175355973 20:58368479-58368501 ATGTCCCACTTTGTGATCTGAGG - Intergenic
1176076908 20:63252811-63252833 ATGTTCCCGTTTCACCTCTGCGG - Intronic
1178013072 21:28308977-28308999 ATTTTTGCATTTGAAATCTGAGG + Intergenic
1180251828 21:46595279-46595301 ATGGTCCCACTTCAGACCTGGGG + Intergenic
1181738117 22:24898035-24898057 AGGTTCCCATTGGGGATCTTGGG - Exonic
1182360535 22:29744022-29744044 ATCCTCCCATTTGACATATGGGG - Intronic
1183481811 22:38069340-38069362 ATTTTCCCATCTGTGACCTGAGG - Intronic
950338798 3:12223392-12223414 ATGTTCACATTGCAGATTTGTGG - Intergenic
950382147 3:12625592-12625614 TTGTTCCAATTTTAGTTCTGTGG - Intronic
950438633 3:12994637-12994659 GTGTTCCCATCTGCGAACTGGGG - Intronic
950818814 3:15736005-15736027 GTATCCCTATTTGAGATCTGCGG - Intronic
951141744 3:19170009-19170031 ATGTTCCCATTTGAGATCTGTGG + Intronic
953146404 3:40279828-40279850 GACTTCCCATTTGAGATTTGTGG + Intergenic
953225687 3:41017428-41017450 GAGTGCCCTTTTGAGATCTGAGG + Intergenic
953540257 3:43811752-43811774 ATTTTCTCATCTGAGAACTGGGG - Intergenic
955211128 3:56942024-56942046 GTTTTCCCATTTGAAAACTGGGG + Intronic
956284272 3:67592139-67592161 ATTTTCCCACATGAGATCTTGGG - Intronic
956293297 3:67684559-67684581 ATGTTCACATTTTAGTTGTGGGG + Intergenic
956450319 3:69368187-69368209 ATGTTCCCATTTTACAGATGAGG + Intronic
956715085 3:72072109-72072131 GTGTTCCCATTTGACAGGTGAGG - Intergenic
956891288 3:73616818-73616840 ATGATCCCATTTTAGAGGTGAGG + Intronic
960135315 3:114098416-114098438 TTGTTCCCATTTTATATTTGAGG + Intergenic
960571877 3:119192460-119192482 GTGTGCCCATTTGAGCTCTGTGG - Intronic
961137759 3:124527740-124527762 AGGTTCCCACTTGACTTCTGGGG - Intronic
961831724 3:129626613-129626635 GACTTCACATTTGAGATCTGAGG + Intergenic
963212425 3:142707996-142708018 ATTTCCCCATTTTAGATATGGGG - Intronic
963794229 3:149615710-149615732 TTGGTCTCATTTGATATCTGAGG + Intronic
966023373 3:175243812-175243834 ATCTTCCCATTTCAGACCTTGGG - Intronic
966559594 3:181305239-181305261 AAGTACCCAATTGTGATCTGCGG - Intergenic
967875094 3:194263186-194263208 GTTTGCCCATTTGAGATATGCGG - Intergenic
969157204 4:5221537-5221559 ATATCCCCATTTCACATCTGAGG - Intronic
970006050 4:11411929-11411951 ATTTTCCCATCTGAAATATGGGG + Intronic
971025343 4:22584029-22584051 GTTTTCCCATTTTAAATCTGAGG - Intergenic
971275386 4:25191723-25191745 ATGTTTCTATTTGACAGCTGGGG - Intronic
971387991 4:26159229-26159251 GTGTTCTCATTTTACATCTGAGG + Intergenic
971395847 4:26226552-26226574 ATTTCCCCATTTTAGAACTGAGG - Intronic
972049330 4:34709292-34709314 ATATTACCAATAGAGATCTGCGG + Intergenic
973231426 4:47843439-47843461 AGCTTCCTATTTGAAATCTGTGG - Intergenic
973537776 4:51901249-51901271 TTGTTCCCATGTCAGCTCTGAGG + Intronic
976745799 4:88401834-88401856 ACGTGCCCATTTGAAATCTGTGG + Intronic
977699705 4:100007287-100007309 ATGTTTCCTTTTGGGAGCTGTGG - Intergenic
978972220 4:114822433-114822455 ATGTCCTCATTTGAGATGTCAGG + Intergenic
979761780 4:124414854-124414876 CTGTTCCCAGTTGGGTTCTGAGG - Intergenic
980476630 4:133326499-133326521 ATTTTACCATTTGAAATTTGAGG + Intergenic
983865852 4:172765742-172765764 ATGTTCTCATCTGAGCTGTGTGG - Intronic
986908695 5:12526759-12526781 TTGTACCCATTAGAGATCTAAGG - Intergenic
988215255 5:28263571-28263593 ATCTTCCTATTTGAAATCTAAGG + Intergenic
989125387 5:38047662-38047684 CTGTTCTCATTTTAGAGCTGAGG - Intergenic
991360954 5:65819387-65819409 ATATTCCCATTTGACAGATGAGG + Intronic
991913165 5:71581542-71581564 ATTTGCCGATGTGAGATCTGGGG + Intergenic
994972974 5:106766417-106766439 ATGCTGCCATTAGAGATGTGCGG - Intergenic
995024206 5:107399691-107399713 ATGTTCTCATGTAACATCTGAGG - Intronic
996757676 5:126951789-126951811 ATGTTTCCATTTGAGTTCTTTGG + Intronic
997571932 5:134936243-134936265 AGGTTCCCCTTGGACATCTGTGG + Intronic
997759671 5:136433083-136433105 ATGTTCCCATCAGAGCTCTCTGG - Intergenic
997944054 5:138183464-138183486 ATGAATCCAGTTGAGATCTGGGG - Exonic
998997147 5:147877991-147878013 ATGTTCCCATTTTAGATGAGAGG + Intronic
999056222 5:148580114-148580136 TTGTTCCCATTTTATAGCTGAGG - Intronic
999114434 5:149150040-149150062 AGGTACCCATAGGAGATCTGAGG - Intronic
1001386073 5:171339712-171339734 ATGTTGCCTTTTGGTATCTGTGG - Intergenic
1001596810 5:172903742-172903764 TTGTCCCCATTTTACATCTGGGG + Intronic
1001726999 5:173912398-173912420 ATGTTGCCATTTGAGAACACTGG + Intronic
1001930115 5:175666770-175666792 ATGGTCCCAAATGAGCTCTGTGG - Intronic
1002111375 5:176916233-176916255 TTGTTCCTTTTTGAAATCTGTGG - Intronic
1004059101 6:12173790-12173812 ATGTTGCCAAATGAGATCTAAGG + Intergenic
1004145161 6:13059103-13059125 ATGTTCCATTTTGACATTTGGGG + Intronic
1004555443 6:16692817-16692839 ATCTGCCAATTTGAGATCTTGGG - Intronic
1006420470 6:33930833-33930855 TGGTTCCCATTTTACATCTGAGG - Intergenic
1007207858 6:40167217-40167239 ATAGTCCCATTGGAGAACTGTGG + Intergenic
1007252706 6:40506877-40506899 AGGGTCCCATTTGGCATCTGAGG - Intronic
1009858705 6:69296610-69296632 ATGTTCTCACTTGAGTTCTTTGG + Intronic
1010635672 6:78256636-78256658 ATGCTCCCATTAGAAGTCTGTGG - Intergenic
1011090169 6:83588929-83588951 AAATTCCCATTTGAGATCTGTGG + Intronic
1012547853 6:100440222-100440244 ATGTCCCCATTTCACATATGGGG + Intronic
1014256957 6:119170083-119170105 CTGACCCCATTTGAGATGTGGGG + Intergenic
1018237154 6:161737619-161737641 TTATTCCCATTTGAAAACTGTGG + Intronic
1018319519 6:162592457-162592479 TTGTCCCCATTTGGGTTCTGTGG + Intronic
1020785475 7:12568200-12568222 ATTTTCCCATTTTAGAGATGAGG + Intergenic
1020950378 7:14668523-14668545 TTGTTCCCATTTTACATATGAGG - Intronic
1022658112 7:32339866-32339888 GGGTGGCCATTTGAGATCTGTGG + Intergenic
1022871595 7:34486055-34486077 ATGTTCCTTCTTGACATCTGGGG - Intergenic
1022886005 7:34644562-34644584 ATGATCCCATTTGAAGTCAGGGG + Intergenic
1023628154 7:42137072-42137094 ATTTTCCCCTTTGACATATGAGG - Intronic
1024943410 7:54785108-54785130 CTGTTCTCATTTTAGAGCTGTGG + Intergenic
1025724394 7:64043977-64043999 ATGTTCCCATGTTAACTCTGTGG + Intronic
1028711365 7:93912831-93912853 ATATACCCATTTGTGATCTAAGG - Intergenic
1032988090 7:137361271-137361293 ATTTTTGCATTTGAGATCTTGGG + Intergenic
1033824234 7:145169955-145169977 ATGTTCCCATATTACATCTGGGG + Intergenic
1038070730 8:24009930-24009952 ATGAACCCATTAGAGAGCTGAGG - Intergenic
1040075084 8:43221075-43221097 TTGTTCCCATTTGACAGGTGAGG + Intergenic
1041824671 8:62080850-62080872 ATTTTCCCATTTGAAAACCGAGG + Intergenic
1041959261 8:63593927-63593949 ATGCTCACACTTGATATCTGGGG + Intergenic
1042719159 8:71808211-71808233 ATGTTCTCATTTGGGAACTCAGG - Intergenic
1044476181 8:92629100-92629122 AGGTTCCAATTTGAGATATAAGG - Intergenic
1044513338 8:93109562-93109584 ATGGGCCCATTTGAGAGATGGGG + Intergenic
1044931492 8:97256199-97256221 GTTTTCCCATTTGTGAACTGGGG + Intergenic
1045388925 8:101695750-101695772 ATGTTCTCCTTTTAGATGTGAGG + Intronic
1047832817 8:128655160-128655182 GTGTTGAAATTTGAGATCTGAGG + Intergenic
1048850262 8:138638454-138638476 ATGTTTCCATGAGAGAACTGTGG - Intronic
1051812615 9:21067428-21067450 AAGTGCACATTAGAGATCTGGGG - Intergenic
1052871640 9:33512977-33512999 TTGTTCCCATTTGACAGGTGAGG + Intergenic
1053005236 9:34599927-34599949 ATGATCCCATTTTACTTCTGAGG - Intergenic
1055086132 9:72315837-72315859 ATGTTCCCCTTTGATTTCTGTGG - Intergenic
1056487178 9:87071195-87071217 ATTTTCCCATTTTACATATGAGG - Intergenic
1057685960 9:97234978-97235000 TTGTTCCCATTTGACAGGTGAGG - Intergenic
1057751045 9:97793394-97793416 GAGTGCTCATTTGAGATCTGTGG + Intergenic
1058409275 9:104712999-104713021 AAGTTCTCATTTGAGAACTGTGG - Intergenic
1059967945 9:119634531-119634553 ATGTTCCCATTTTAGAGAGGAGG - Intergenic
1060507443 9:124208749-124208771 AGGTGCCCATTTGAGGTCTGTGG - Intergenic
1060783220 9:126429023-126429045 ATGTTCCTGTCTCAGATCTGGGG - Intronic
1061410401 9:130417990-130418012 GTGTTCCCATCTGAAATATGGGG - Intronic
1187181631 X:16947757-16947779 AATTTCCCATTTGAGATTAGAGG + Intronic
1187816106 X:23233624-23233646 GTGTTCCCATTTGATGTATGGGG + Intergenic
1188159908 X:26786414-26786436 TTGTACCCATCAGAGATCTGAGG + Intergenic
1189134968 X:38539247-38539269 ATGTCCCCATTTCAGTTCTTGGG + Intronic
1190076609 X:47321756-47321778 ATGTTCCCATGGGAGATCTGAGG + Intergenic
1191675970 X:63792918-63792940 ATGTTTCCTTTTGAGGTCGGGGG - Intergenic
1193450219 X:81656082-81656104 ATGTTTCCCTCTGAGATTTGGGG + Intergenic
1196405539 X:115358678-115358700 ATGTCCTCAGGTGAGATCTGAGG + Intergenic
1197121371 X:122897272-122897294 ATGTTCCCATTTTACATATGGGG - Intergenic