ID: 951146607

View in Genome Browser
Species Human (GRCh38)
Location 3:19234555-19234577
Sequence CGCCCACGCGGAACTCCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1912
Summary {0: 1, 1: 13, 2: 644, 3: 670, 4: 584}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951146601_951146607 6 Left 951146601 3:19234526-19234548 CCAATCCGAGTGCGGGGTCCGCG 0: 1
1: 1
2: 15
3: 90
4: 196
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584
951146602_951146607 1 Left 951146602 3:19234531-19234553 CCGAGTGCGGGGTCCGCGAGCCC 0: 1
1: 0
2: 1
3: 32
4: 442
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584
951146600_951146607 10 Left 951146600 3:19234522-19234544 CCGGCCAATCCGAGTGCGGGGTC 0: 1
1: 2
2: 25
3: 135
4: 489
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584
951146594_951146607 29 Left 951146594 3:19234503-19234525 CCCAGGCGGGTGGGGCTGGCCGG 0: 1
1: 0
2: 5
3: 65
4: 421
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584
951146596_951146607 28 Left 951146596 3:19234504-19234526 CCAGGCGGGTGGGGCTGGCCGGC 0: 1
1: 0
2: 8
3: 66
4: 536
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584
951146593_951146607 30 Left 951146593 3:19234502-19234524 CCCCAGGCGGGTGGGGCTGGCCG 0: 1
1: 0
2: 4
3: 25
4: 297
Right 951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG 0: 1
1: 13
2: 644
3: 670
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951146607 Original CRISPR CGCCCACGCGGAACTCCCGC TGG Intronic
900113299 1:1018627-1018649 CGCCCACTCGGAACTCCAGCTGG + Intergenic
900463646 1:2813315-2813337 CACCCACCCGGAGCTCACGCTGG - Intergenic
900502364 1:3012684-3012706 GCCCCACGCGGCGCTCCCGCGGG + Intergenic
901046000 1:6396045-6396067 CGCCCACCTGGAACTCGCCCTGG + Intergenic
901601501 1:10426675-10426697 CGCCCACCCGGAACTCCAGCTGG + Intergenic
901783317 1:11608802-11608824 TGCCCACCCGGAACTCCAGCTGG - Intergenic
902032645 1:13434164-13434186 CGCCCACCCGGGATTCACGCTGG + Intergenic
902963982 1:19984767-19984789 CGCCCACCCGGAACTTGCGCTGG + Intergenic
903624581 1:24721569-24721591 CGCCCACCCGGAACTCGCGCTGG - Intergenic
904238899 1:29131393-29131415 CGCCCACCCGGAACTCGCGCTGG + Intergenic
905375605 1:37518296-37518318 CGCCCACCCGGAACTCCAGCTGG - Intergenic
905584259 1:39105113-39105135 GGCCCACGCGGGAGTCCCGCTGG - Intronic
905742866 1:40387897-40387919 TGCCCACCCGGAACTCCAGCTGG - Intronic
905761171 1:40559187-40559209 CGCCCACCCGGAACTCGCGCTGG + Intergenic
906056007 1:42917303-42917325 CACCCACCCGGAACTCACGCTGG + Intergenic
906083237 1:43107825-43107847 CGCCCACCCGGAACTCCAGCTGG + Intergenic
906563536 1:46778821-46778843 TGCCCACCCGGAACTCCAGCTGG + Intronic
906877734 1:49557023-49557045 CGCTCACTCGGAACTCGCACTGG + Intronic
907102256 1:51847682-51847704 CGCCCACCTGGAACTCTAGCTGG + Intronic
907759522 1:57343722-57343744 CGCCCACCCAGAACTCGCGCTGG + Intronic
907889470 1:58623476-58623498 CGCCCACCCGGAACTCCAGCTGG - Intergenic
907980037 1:59472173-59472195 CACCCACCCGGAACTCACGCTGG - Intronic
908027780 1:59969980-59970002 CGCCCACCCGGAACTCCAGCTGG + Intergenic
908291310 1:62669934-62669956 CGCCCACCCGGAACTCCAGCTGG - Intronic
908301076 1:62761558-62761580 CGCCCACCTGGAACTCATGCTGG - Intergenic
908888564 1:68817765-68817787 CGCCCACCCGGAACTCCAGCTGG - Intergenic
909318058 1:74248223-74248245 CGCCCACCCAGAACTCACGCTGG + Intronic
909318571 1:74253662-74253684 CGCCCACCCAGAACTCTAGCTGG + Intronic
909377099 1:74952363-74952385 CGCCCACCCGGAACTCCAGCTGG + Intergenic
909904591 1:81178927-81178949 CGCCCACCCGGAACTCCAGCTGG + Intergenic
910034791 1:82777097-82777119 CGCCCACCTGGAACTCCAGCTGG + Intergenic
910550257 1:88467101-88467123 CGCCCATCCGGAACTCTAGCTGG - Intergenic
910609779 1:89128360-89128382 CGCCCACCCGGAACTCCAGCTGG + Intronic
910622677 1:89273641-89273663 AGCCCACCCAGAACTCGCGCTGG + Intergenic
910685732 1:89914274-89914296 CGCCCACCCGGAACTCCAGCTGG + Intronic
910693158 1:89984933-89984955 CGCCCACCCGGAACTCGCGCTGG + Intergenic
911001432 1:93170313-93170335 CGCCCACCCGGAACTCGAGCTGG - Intronic
911205904 1:95091435-95091457 CGCCCACCCGGAACTCCAGCTGG - Intergenic
911259626 1:95669943-95669965 CACCCACCCGGAACTCCAGCTGG + Intergenic
911839275 1:102660328-102660350 CGCCCACCCGGAACTCCAGCTGG + Intergenic
911954517 1:104217760-104217782 TGCCCACCCGGAACTCCAGCTGG + Intergenic
912069851 1:105795954-105795976 CGCCCACCTGGAACCCGCGCTGG - Intergenic
912166125 1:107044800-107044822 CGCCCACCCGGAACTCCAGCTGG - Intergenic
912312904 1:108641176-108641198 CGCCCACCCGGAACTCCAGCTGG + Intronic
912538784 1:110396653-110396675 CACCCACCCGGAACTCTAGCTGG + Intergenic
912819400 1:112854829-112854851 CGCCTACCCGGAACTCCAGCTGG + Intergenic
912824671 1:112894743-112894765 CACCCACGAAGAACTCGCGCTGG - Intergenic
913161089 1:116146871-116146893 CGCCCACCCGGAACTCCAGCTGG + Intergenic
913468985 1:119171592-119171614 TGCCCACCTGGAACTCACGCTGG - Intergenic
913470173 1:119179111-119179133 CGCCCACCCGGAACTCTCACTGG - Intergenic
913486096 1:119333798-119333820 TGCCCACCCAGAACTCGCGCTGG - Intergenic
913692138 1:121289420-121289442 CGCCCACCCGGAACTCCAGCTGG + Intronic
914000747 1:143692340-143692362 CGCCCCGGCTGAACTCCCGCAGG + Intergenic
914145417 1:144990694-144990716 AGCCCACCCGGAACTCCAGCTGG - Intronic
914203455 1:145506168-145506190 CGCCCACCCTGAACTCCGGCTGG + Intergenic
914438466 1:147681082-147681104 CGCCCACCCAGAACTCCAGCTGG + Intergenic
914482577 1:148079322-148079344 CGCCCACCCTGAACTCCGGCTGG + Intergenic
914928036 1:151906181-151906203 CACCCACCTGGAACTCCAGCTGG - Intronic
915104102 1:153521831-153521853 CACCCACCCGGAACTCCAGCTGG - Intergenic
915260026 1:154670795-154670817 CGCCCACCCGGAACTCCAGATGG - Intergenic
915261196 1:154678082-154678104 CGCCCACCCGGAACTCCAGCTGG - Intergenic
915666133 1:157446596-157446618 CGCCCACCCGGAAATCCAGCTGG + Intergenic
915764512 1:158349304-158349326 CGCCCACCCTGCACTCCAGCTGG + Intergenic
915767179 1:158374442-158374464 CGCCCACCCCGAACCCCAGCTGG + Intergenic
915865581 1:159494924-159494946 CGCCCACTCGGAACTCCAGCTGG + Intergenic
916910136 1:169337393-169337415 CGCCCACCCGGAACTCCAGCTGG + Intronic
916939012 1:169661261-169661283 CGCCTACCCGGAACTCGCGCAGG - Intergenic
916960257 1:169882156-169882178 CGCCCACCCAGAACTCCAGCTGG - Intronic
917348890 1:174056688-174056710 CGCCCACCCAGAACTCGCGCTGG + Intergenic
917406243 1:174711153-174711175 CGCCCACCCGGAACTCACGCTGG + Intronic
917578575 1:176349586-176349608 CGCCCACCCGGAACTCCAGCTGG + Intergenic
917860492 1:179138885-179138907 CGCCCACCCGGAACTCCAGCTGG - Intronic
917933026 1:179837246-179837268 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918058977 1:181045879-181045901 CGCCCACTTGGAACTCCAGCTGG - Intronic
918512031 1:185321997-185322019 TGCCCACCCGGAACTCGCGCTGG + Intergenic
918542729 1:185649243-185649265 CGCCCACCCCGAACTTGCGCTGG + Intergenic
918659783 1:187074132-187074154 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918720808 1:187850246-187850268 CGCCCACCCGGAACTCTGGCTGG - Intergenic
918789947 1:188813132-188813154 CGCCCACCCGGAACTCTAGCTGG - Intergenic
918792066 1:188841490-188841512 CGCCCACCCGGAACTCCAGCTGG + Intergenic
918853237 1:189718613-189718635 CGTCCACCCGGAACTCCAGCTGG + Intergenic
918943002 1:191026310-191026332 CGCCCACCCAGAACTCGGGCTGG + Intergenic
918951986 1:191151470-191151492 CGCCCACCCGGAACTCGCGCTGG - Intergenic
918993869 1:191731859-191731881 CGCCCACCCGGAACTCGCGCTGG - Intergenic
919049813 1:192499376-192499398 CGCCCACCCGGAACTCACGCTGG + Intergenic
919091876 1:192986955-192986977 CGCCCACCCGGAACTCCAGCTGG - Intergenic
919167978 1:193919228-193919250 CGGCCACCCGGAACTCCAGCTGG + Intergenic
919174444 1:194001886-194001908 CGCCCACCGGGAACTCCAGCAGG - Intergenic
919201377 1:194358585-194358607 CGCCCACCCGGAACTCCAGCTGG + Intergenic
919237014 1:194859111-194859133 CGCCCACCCGGAACTCCAACTGG - Intergenic
919297794 1:195723204-195723226 CGCCCACCCGGAACTCGCACTGG + Intergenic
919630934 1:199959718-199959740 CGCCCACTCAGAACTCGCGCTGG - Intergenic
920150202 1:203900281-203900303 CGCCCACCCGGAACTCTAGCTGG - Intergenic
920479462 1:206307768-206307790 CGCCCACCCGGAACTCCAGCTGG + Intronic
920731393 1:208488754-208488776 CGCCCACCCGGAACTCCAGCTGG + Intergenic
920756654 1:208739723-208739745 CGCCCACCCAGAACTCCAGCTGG - Intergenic
920878484 1:209858966-209858988 CGCCCACCCGGAACTCGCGCTGG + Intergenic
920882057 1:209889255-209889277 CGCCCACCCAGAACTCGCGCTGG + Intergenic
920883174 1:209899116-209899138 CGCCCACCCGGAACTCCAGCTGG + Intergenic
921396413 1:214673462-214673484 CGCCCACCCGGAACTCCAGCTGG + Intergenic
921801780 1:219410696-219410718 CGCCCACCAGGAACTCCAGCTGG - Intergenic
921897070 1:220412476-220412498 CACCCACCCAGAACTCCAGCTGG - Intergenic
921903873 1:220476010-220476032 CGCCCACCCAGAACTCCAGCTGG + Intergenic
921983703 1:221285974-221285996 CGCCCACCCGGAACTCCAGCTGG + Intergenic
922056804 1:222049791-222049813 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922166164 1:223117255-223117277 CGCCCACCCAGAATTCGCGCTGG + Intronic
922306995 1:224352800-224352822 CGCCCACCCAGAACTCGCGCTGG + Intergenic
922423185 1:225472751-225472773 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922485400 1:225969814-225969836 CGCCCACCCGGAACTCCAGCTGG - Intergenic
922546830 1:226464242-226464264 CGCCCACCTGGAACTCGCACTGG - Intergenic
922855767 1:228773750-228773772 CGCCCACCCGGAACTCCAGCTGG - Intergenic
923157259 1:231289791-231289813 CGCCCACCCAGAACTCCAGCTGG + Intergenic
923193473 1:231642220-231642242 TGCTCACCCGGAACTCGCGCTGG + Intronic
923324835 1:232871760-232871782 CGCCCACCCGGAACTCCAGCTGG + Intergenic
923353156 1:233129168-233129190 CGCCCATCCGGAACTCTAGCTGG - Intronic
923573784 1:235140329-235140351 CGCCCACCTGGAACTCCAGCTGG - Intronic
923623249 1:235594697-235594719 CGCCCACCCAGAACTCACGCTGG + Intronic
923930103 1:238684946-238684968 TGCCCACCTGGAACTCCAGCTGG + Intergenic
924117495 1:240762535-240762557 CGCCCACCCGGAACTCCAGCTGG - Intergenic
924219262 1:241855893-241855915 CGCCCACCCGGAACTCCAGCTGG + Intronic
924305921 1:242689472-242689494 TGCCCACCCAGAACTCACGCTGG - Intergenic
1063148981 10:3320143-3320165 CGCCCACCCAGAACTCGAGCTGG + Intergenic
1063318759 10:5032833-5032855 TGCCCACCGGGAACTCCAGCTGG + Intronic
1063321062 10:5053416-5053438 TGCCCACCCGGAACTCGTGCTGG + Intronic
1063322197 10:5060957-5060979 TGCCCACCTGGAACTCACGCTGG + Intronic
1063769670 10:9183394-9183416 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1063848682 10:10160941-10160963 CGCCCACCTGGAACTCACACTGG - Intergenic
1064197763 10:13259650-13259672 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1064410091 10:15097394-15097416 CGCCCACCTGGAACTCACGATGG - Exonic
1064449237 10:15426391-15426413 CGCCCACCCGGAACTCGTGCTGG + Intergenic
1064790382 10:18951593-18951615 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1065441310 10:25756043-25756065 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1065554876 10:26905590-26905612 CACCCACCTGGAACTCGCGCTGG - Intergenic
1065590293 10:27256524-27256546 CGCCCACCCGGAACTCACGCTGG - Intergenic
1065743306 10:28815989-28816011 CGCTCACCCGGAACTCCAGCTGG + Intergenic
1065752192 10:28897092-28897114 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1065802584 10:29366239-29366261 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1065895873 10:30162899-30162921 CACCCACCCAGAACTCGCGCTGG - Intergenic
1065981594 10:30903114-30903136 CGCCCACCCGGAACTCTAGCTGG + Intronic
1065995478 10:31055868-31055890 CGCCCACCCAGAACTCTAGCTGG - Intergenic
1066186277 10:33013336-33013358 CGCCCACCCGGAACTCCACCTGG - Intergenic
1066190234 10:33049270-33049292 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1066234018 10:33468078-33468100 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1066296079 10:34055599-34055621 CACCCACCCGGAACTCGCGCTGG - Intergenic
1066544268 10:36482312-36482334 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1066567427 10:36734935-36734957 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1066597064 10:37062512-37062534 CGCCCACCTGGAACTCCCGCTGG - Intergenic
1066598188 10:37076052-37076074 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1066648480 10:37634517-37634539 CGCCCACCTGGAACTCACGCTGG - Intergenic
1066660878 10:37737419-37737441 CGCCCACCCAGAACTCGTGCTGG - Intergenic
1067363164 10:45600788-45600810 CTCCCACCGGGAACTCCAGCTGG - Intergenic
1068373995 10:56155167-56155189 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068455515 10:57249884-57249906 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1068460348 10:57321565-57321587 CGCCCACCTGGAACTTGCGCTGG - Intergenic
1068863143 10:61867689-61867711 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068902088 10:62280422-62280444 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1068978111 10:63033633-63033655 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1069186549 10:65429732-65429754 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1069215373 10:65812369-65812391 TGCCCACCCGGAACTCGTGCTGG + Intergenic
1069988650 10:72300653-72300675 CGCCCACCGGGAACTCGCGCTGG - Intergenic
1069992944 10:72326000-72326022 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1070564089 10:77590503-77590525 CACCCACCCGGAACTCGCGCTGG + Intronic
1070937870 10:80315476-80315498 TGCCCACCTGGAACTCGCGCTGG - Intergenic
1070942583 10:80359805-80359827 CGCCCACCCGGAACTTGCGCTGG + Intronic
1070973360 10:80585922-80585944 CGCCCACCCAGAAATCCAGCTGG - Intronic
1070999127 10:80814236-80814258 TGCCCACCCGGAACTCCCGTTGG - Intergenic
1071003730 10:80859280-80859302 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1071037506 10:81265230-81265252 CACCCACCCAGAACTCCAGCTGG + Intergenic
1071041121 10:81309404-81309426 CGCCCACCCGGAACTTGCCCTGG + Intergenic
1071055677 10:81505871-81505893 TGCTCACCCGGAACTCGCGCTGG - Intergenic
1071078697 10:81784263-81784285 TGCCCACCCAGAACTCACGCTGG - Intergenic
1071085382 10:81863003-81863025 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1071387977 10:85141444-85141466 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1071797087 10:89018891-89018913 CGCCCACCTGGAACTCATGCTGG + Intergenic
1071963805 10:90832491-90832513 CGCCCACCCGGAACTCCAGCTGG + Intronic
1072107890 10:92291303-92291325 CGCCTCCGCCGGACTCCCGCAGG + Exonic
1073532493 10:104245219-104245241 CGCCCACCCAGAACTCGCGCTGG - Intronic
1073789795 10:106928409-106928431 CGCCCACCCGGAACTCCAGCTGG + Intronic
1073878291 10:107950623-107950645 TGCCCACCCAGAACTCGCGCTGG - Intergenic
1073970333 10:109040796-109040818 CGCCCACCCGGAACCCTCGCCGG - Intergenic
1074098105 10:110331503-110331525 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1074316986 10:112369832-112369854 CGCCCACCCGGAACTCTCGCTGG - Intergenic
1074317121 10:112370355-112370377 CACCCACCCGGAACTCGGGCTGG - Intergenic
1074503320 10:114044864-114044886 GGGCCTCGCGGAACACCCGCAGG - Exonic
1074732451 10:116393448-116393470 CGCCCACGCGGAACTCACGCTGG - Intergenic
1074996372 10:118760463-118760485 AGCCTACCCGGAACTCGCGCTGG + Intergenic
1074999206 10:118782947-118782969 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1075255593 10:120923869-120923891 CGCCCACCCGGAACTTCAGCTGG - Intergenic
1075269404 10:121035655-121035677 CGCGCACCCGGAACTCCAGCTGG + Intergenic
1075305694 10:121365622-121365644 CGCCCACCTGGAACTCGGGCTGG - Intergenic
1075307608 10:121382207-121382229 CACCCACCCGGAACTCGCGTTGG - Intergenic
1075376048 10:121978695-121978717 CGCCCACAGGGAACTCTAGCTGG + Intergenic
1075505031 10:123013819-123013841 CGCCCACCCGGAACTCTAGCTGG + Intronic
1075537555 10:123283670-123283692 CGCCCACCTGGAACTCTAGCTGG + Intergenic
1076261685 10:129071668-129071690 CGTCCACCCGGAACTCCAGCTGG + Intergenic
1076773588 10:132680706-132680728 CGCCCACCCGGAAATCCAGCTGG - Intronic
1076796559 10:132801252-132801274 CGCCCACCCGGAAATCCAGCTGG + Intergenic
1077206879 11:1349066-1349088 CGCCCACCCGGAGCTCCCCGGGG + Intergenic
1077465009 11:2729763-2729785 CACCCATGGGGACCTCCCGCAGG - Intronic
1077583812 11:3435259-3435281 TGCCCACCCGGCACTCGCGCTGG + Intergenic
1077603222 11:3588772-3588794 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1077764566 11:5144459-5144481 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1077805736 11:5589924-5589946 CGCCCACCCGGAACTCCAGCTGG - Intronic
1077815591 11:5682992-5683014 CGCCCACCCGGAACTCCAGCTGG - Intronic
1078251922 11:9623353-9623375 CGCACACCCGGAACTCCAGCTGG + Intergenic
1078301225 11:10133620-10133642 CGCCCACCCGGAACTCCAGCTGG + Intronic
1078743718 11:14091643-14091665 CGCCCACCCAGAACTCCAGCTGG + Intronic
1078795796 11:14591107-14591129 TGCCCACCTGGAACTCCAGCTGG - Intronic
1079191003 11:18276408-18276430 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1079708697 11:23653465-23653487 CGCCCACCTGGAACTCGTGCTGG + Intergenic
1079726245 11:23883747-23883769 CGCCCACCCAGAACTCCAGCGGG + Intergenic
1079730589 11:23935040-23935062 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1079731780 11:23942593-23942615 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1079756827 11:24274555-24274577 CGCACACCCGGAACTTGCGCTGG + Intergenic
1079767807 11:24416335-24416357 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1079867593 11:25756163-25756185 CGCCCACCCAGAACTCACACTGG - Intergenic
1080106046 11:28512647-28512669 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1080195222 11:29600462-29600484 CGCCCACCCGGAACGCCAGCTGG + Intergenic
1080557718 11:33432059-33432081 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1080621420 11:33990144-33990166 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1081046432 11:38278915-38278937 CGCCCACCCAGAGCTCGCGCTGG + Intergenic
1081047715 11:38296583-38296605 CGCCCACCCGGAACTCGCACTGG + Intergenic
1081115355 11:39192867-39192889 TGCCCACCCGGAACTCGCGTTGG + Intergenic
1081125036 11:39311873-39311895 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1081136173 11:39442378-39442400 CGCCCACCCAGAACTCCCCCTGG + Intergenic
1081324489 11:41728399-41728421 CACCCACCCGGAACTCTAGCTGG + Intergenic
1081420871 11:42873963-42873985 CGCCCACCCGCAACTCCAGCTGG - Intergenic
1081422044 11:42881428-42881450 CGCCCACCCAGAACTCCACCTGG - Intergenic
1081428355 11:42949921-42949943 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1082270447 11:50164317-50164339 CACCCACCCAGAACTCGCGCTGG + Intergenic
1082272091 11:50183317-50183339 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1082734898 11:56845242-56845264 CGCCCACCCAGAACTCGTGCTGG - Intergenic
1083074318 11:60020532-60020554 CGCCCACCCAGAACTTGCGCTGG + Intergenic
1083546086 11:63550250-63550272 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084024769 11:66441049-66441071 CGCCCACCCGGAACTTGCGCTGG + Intronic
1084107383 11:66988839-66988861 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084186627 11:67476137-67476159 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1084210433 11:67619081-67619103 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1084240716 11:67817932-67817954 TGCCCACCCGGCACTCGCGCTGG + Intergenic
1084259117 11:67963314-67963336 CCCCCACCCAGAACTCCAGCCGG - Intergenic
1084813651 11:71631864-71631886 CGCCCACCCAGAACTCCAGCCGG + Intergenic
1085245576 11:75098251-75098273 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1085375858 11:76060610-76060632 CGCCCACCCGGAACTCCAGCTGG - Intronic
1085447271 11:76609345-76609367 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1085863100 11:80257607-80257629 CGCCCACCCGGAACTCACGCTGG - Intergenic
1085982825 11:81744842-81744864 CGCCCACCCAGAACTCGCGGTGG + Intergenic
1086001112 11:81986991-81987013 CACCCACCTGGAACTCGCGCTGG + Intergenic
1086001634 11:81991193-81991215 TGCCCACCTGGAACTCACGCTGG + Intergenic
1086034882 11:82403945-82403967 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1086043007 11:82501204-82501226 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1086087537 11:82970718-82970740 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1086200392 11:84194911-84194933 CGCCCACCCGGAACTCGTCCTGG + Intronic
1086210147 11:84308851-84308873 CGCTCACCCGGAACTCACGCTGG + Intronic
1086397773 11:86433837-86433859 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1086724624 11:90167234-90167256 CGCCCACCCGGAACTCTCGCTGG - Intronic
1086807988 11:91268801-91268823 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1087354514 11:97076645-97076667 CGCCCACCCGGAAATCCAGCTGG - Intergenic
1087400987 11:97667126-97667148 CGCCCACCTGGAACTCCCCCTGG - Intergenic
1087486414 11:98763725-98763747 GGCCCACCCCGAACTCCAGCTGG + Intergenic
1087962260 11:104366526-104366548 CACCCACCCGGAACCCGCGCTGG + Intergenic
1088481729 11:110301215-110301237 CGCCTACCCCGAACTCCTGCTGG + Intergenic
1088570850 11:111222023-111222045 CGCCCACCCGGAACTCCAGATGG - Intergenic
1089062145 11:115634209-115634231 AGCCCACCCGGAACTCCAGATGG + Intergenic
1089373599 11:117978803-117978825 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1089466430 11:118689289-118689311 CGCCAACCCGGAACTCCACCTGG + Intergenic
1089666836 11:120025943-120025965 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1089800213 11:121021704-121021726 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1090133577 11:124170999-124171021 CGCCCACCCGGAACTCACGCTGG + Intergenic
1090229196 11:125089542-125089564 TGCCCACCCGGAACTCCAGCTGG - Intronic
1090307710 11:125705018-125705040 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1090586213 11:128215586-128215608 CGCCCACCTGGAACTCGCCCTGG + Intergenic
1090588236 11:128237135-128237157 CGCCCACCCGGAACTCACGCTGG - Intergenic
1090776749 11:129972136-129972158 CGCCCACCCAGAACTCCAGCTGG + Intronic
1090782701 11:130021717-130021739 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1090820544 11:130337675-130337697 CGCCTACCCGGAACTCACGCTGG + Intergenic
1091233478 11:134003178-134003200 CGCCCCCCCGGAACTCCAGCTGG + Intergenic
1091402269 12:188390-188412 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1092101712 12:5889163-5889185 CGCCCACCCAGAACTCGCGCTGG + Intronic
1092133938 12:6132663-6132685 CGCCCATCCGGAACTCGCGCTGG - Intergenic
1092137404 12:6159521-6159543 CGCCCACCCTGAACTCCAGCTGG - Intergenic
1092142132 12:6191186-6191208 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1092220271 12:6708354-6708376 CGGCCACCCGGAACTCCAGCTGG - Intergenic
1092221374 12:6716081-6716103 CACCCACCCGGAACTCCAGCTGG - Intergenic
1092272901 12:7037470-7037492 CGCCCACCTGGAACTCCAGCTGG - Intronic
1092336650 12:7639885-7639907 CGCCCCCCCGGAACTCCAGCTGG - Intergenic
1092350548 12:7752389-7752411 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1092430431 12:8404320-8404342 CGCCCACCCGGAACTCCAGCCGG - Intergenic
1092471744 12:8787311-8787333 CGCCCGCCCGGAACTCCAGCTGG - Intergenic
1092472937 12:8794768-8794790 CGCCCGCCCGGAACTCCAGCTGG - Intergenic
1092545881 12:9450700-9450722 CGCCCACCGGGAACTCGCGCTGG + Intergenic
1092572448 12:9739892-9739914 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1092583834 12:9876356-9876378 CACCCACAGGGAACTCGCGCTGG + Intergenic
1092617181 12:10225948-10225970 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1092732447 12:11547337-11547359 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1092834228 12:12472703-12472725 CGCCCACCTGGAACTCGCACTGG + Intergenic
1093034466 12:14320140-14320162 CGCCCAGCCGGAACTCCAGCTGG - Intergenic
1093172335 12:15874674-15874696 CGCCCACCCAGAACTCGCGCTGG - Intronic
1093189372 12:16057427-16057449 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1093346246 12:18040299-18040321 CGCCCACCCGGAACTCATGCTGG - Intergenic
1093381540 12:18500191-18500213 CGCCCACCTGGAACTCCAGCCGG - Intronic
1093527116 12:20115545-20115567 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1093583297 12:20807746-20807768 CGCCCACCGGGAACTGGCGCTGG + Intergenic
1093652524 12:21661574-21661596 CTCCCACCCGGAACTCTAGCTGG - Intronic
1093653966 12:21674367-21674389 TGCCCACCCGGAACTCGCGTTGG + Intronic
1093793697 12:23285990-23286012 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1093921640 12:24866121-24866143 CTCCCACCCGGAACTCCAGCTGG - Intronic
1093970185 12:25369411-25369433 CGCCAACCCGGAACTCCAGCTGG - Intergenic
1093972932 12:25391473-25391495 CGGCCACCCGGAACTCCAGCTGG - Intergenic
1094108759 12:26839221-26839243 TGCCCACTCGGAACTCGAGCTGG - Intergenic
1094327537 12:29256688-29256710 CGCCCACCCGGAACTCCAGCTGG - Intronic
1094338638 12:29386556-29386578 TGCCCACCGGGAACTCCAGCTGG + Intergenic
1094405379 12:30110764-30110786 TGCCCACCCGGAACTCCCGCTGG + Intergenic
1094409809 12:30156916-30156938 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1094448692 12:30561678-30561700 GGCCCACCCGGAACTCCAGCTGG - Intergenic
1094507075 12:31071373-31071395 CGCCCACCGGGAACTCGCGCTGG - Intergenic
1094589328 12:31806104-31806126 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1094661255 12:32472336-32472358 CGCCCACCCGGAACTCCAGCTGG - Intronic
1094666461 12:32525718-32525740 CGCCCACCTGGAACTCCAGCTGG - Intronic
1094718221 12:33034247-33034269 CACCCACCTGGAACTCCAGCTGG + Intergenic
1094722036 12:33075390-33075412 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1095123072 12:38441997-38442019 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1095444984 12:42274018-42274040 CACCCACCCGGAACTCCAGCTGG + Intronic
1095533952 12:43224367-43224389 CGCCCACCCGGAACTCACGCTGG - Intergenic
1095587387 12:43863944-43863966 TGCCCACCCGGAACTCTAGCTGG - Intronic
1095776680 12:46018063-46018085 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1095901517 12:47333429-47333451 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1097017952 12:56000459-56000481 CGCCCACCCGGAACTCCAGCTGG + Intronic
1097128967 12:56796155-56796177 CGCCCACCCAGAACTTCAGCTGG + Intergenic
1097212921 12:57386357-57386379 CTCCCACCCGGAACTCGTGCTGG - Intronic
1097664214 12:62461549-62461571 TGCCCACCCGGAATTCCAGCTGG + Intergenic
1097981991 12:65744404-65744426 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1098168248 12:67719547-67719569 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1098515967 12:71376902-71376924 CGCACACCCGGAACTCCAGCTGG - Intronic
1098588645 12:72185085-72185107 CGCCCACCCAGAACTCCAGCTGG - Intronic
1098759215 12:74402991-74403013 CGCCCAGCCGGAACTCCAGCTGG - Intergenic
1099190936 12:79561585-79561607 CACCCACCCAGAACTCACGCTGG - Intergenic
1099192418 12:79573963-79573985 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1099204328 12:79710982-79711004 CGCCCACCCGGAACTCCAGGTGG - Intergenic
1099228189 12:79993540-79993562 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1099413731 12:82361733-82361755 CAACCACCCGGAACTCGCGCTGG + Intronic
1099443814 12:82728816-82728838 TGCCCACCTGGAACTCGCGCTGG - Intronic
1099478646 12:83140164-83140186 CGCCCACCCGGAACTCAGGCTGG - Intergenic
1099523957 12:83696602-83696624 CGCCCATCTGGAACTCCAGCTGG + Intergenic
1099559642 12:84155437-84155459 CGCCCACCTGCAACTCCAGCTGG + Intergenic
1099790688 12:87330260-87330282 CGCCCACCCCGAACTCCAGCTGG - Intergenic
1100142314 12:91633989-91634011 CGCCAACCCGGAACTCTAGCTGG - Intergenic
1100166640 12:91924205-91924227 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1100211913 12:92406834-92406856 CGCCCACCTGGAACTCCAGGTGG + Intergenic
1100521437 12:95379653-95379675 CGCCCACCTGGAACTCCAGCTGG - Intronic
1100584672 12:95969179-95969201 CGCCCACCCGGAACTCCAGGTGG - Intergenic
1100600619 12:96108949-96108971 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1100734644 12:97513053-97513075 CGCCCACCCGGAACTCGCGCAGG + Intergenic
1101008962 12:100430346-100430368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1101021597 12:100559426-100559448 CGCCCACCCGGAATTCCAGCTGG - Intronic
1101461989 12:104905828-104905850 CGCCCACCCGGAACTCCAGCTGG + Intronic
1101603822 12:106233066-106233088 TGCCCACCCGGAACTCTAGCTGG - Intergenic
1102309731 12:111835699-111835721 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1102350051 12:112185240-112185262 CGCCCCCCCGGAGCCCCCGCAGG + Exonic
1102387261 12:112520205-112520227 CGCCCACCAGGAACTCGCGCTGG + Intergenic
1102903999 12:116660770-116660792 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1103239125 12:119398353-119398375 CGCCCACCCGGAACTCGTGCTGG + Intronic
1103439260 12:120950656-120950678 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1103459687 12:121093823-121093845 CGCCCACCTGGAACTCGCACTGG + Intergenic
1103668516 12:122592069-122592091 CATCCACCCGGAACTCCAGCTGG - Intronic
1103678735 12:122676913-122676935 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1103783422 12:123414429-123414451 CGCCCACCCGGAACTCCAGCTGG + Exonic
1103853263 12:123946992-123947014 CGCCCACCCAGAACTCCAGCTGG - Intronic
1104344466 12:127983426-127983448 CGCCCACCCGGAACTCTCGCTGG - Intergenic
1104373851 12:128247288-128247310 TGCCCACCTGGAACTCACGCTGG - Intergenic
1104582612 12:130022099-130022121 CCCCCACCCGGAACTCCAGCTGG - Intergenic
1104614545 12:130256970-130256992 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1104749210 12:131227856-131227878 CCCTCACCCGGAACTCCAGCTGG - Intergenic
1105037725 12:132938798-132938820 CGCCCACCCGGAACTCCAGCTGG - Intronic
1105237181 13:18568030-18568052 CGCCCACCCGGACCCCACGCCGG + Intergenic
1105425615 13:20292461-20292483 CACTCACCCGGAACTCCAGCTGG - Intergenic
1105605182 13:21920972-21920994 CTCCCACCCGGAACTCTAGCTGG + Intergenic
1105701566 13:22938953-22938975 CGCCCACCAGGAACTCATGCTGG + Intergenic
1105722152 13:23127616-23127638 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1105723891 13:23142192-23142214 TGCCCACTCGGAACTTTCGCTGG - Intergenic
1105763122 13:23531578-23531600 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1105871170 13:24507122-24507144 CGCCCAACCGGAACTTGCGCTGG + Intronic
1105876712 13:24561021-24561043 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1106221354 13:27748630-27748652 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1106617092 13:31339982-31340004 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1106643455 13:31609142-31609164 CACCCACCCGGAACTCCAGCTGG + Intergenic
1106810922 13:33358025-33358047 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1106840620 13:33682152-33682174 TGCCCACCCGGAACTCACACTGG - Intergenic
1107259407 13:38472746-38472768 CGCCCACCCGGAGCTCCAGCTGG + Intergenic
1107652564 13:42559815-42559837 CTCCCACCCGGAACTTGCGCTGG - Intergenic
1107836086 13:44413620-44413642 CGCCCACCCGGAACTCACGCTGG - Intergenic
1108099205 13:46936370-46936392 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1108435313 13:50396639-50396661 CGCCCACCCGGAACTCCAGCTGG - Intronic
1108469483 13:50753621-50753643 CGCCCACCCGGAACTCGCACTGG + Intronic
1108644004 13:52408391-52408413 CACCCACCCGGAACTCGTGCTGG + Intergenic
1108685482 13:52815532-52815554 CGCCCACCCGGAACTCGCCCTGG + Intergenic
1108751557 13:53452708-53452730 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1108845640 13:54676615-54676637 TGCCCACCTGGAACTCGCGCTGG - Intergenic
1108851640 13:54737592-54737614 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1108856549 13:54799994-54800016 CGCCCATCCGGAACTCGCGCTGG + Intergenic
1108858984 13:54829816-54829838 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1108991165 13:56659425-56659447 TGCCCACCCAGAACTCGCGCTGG + Intergenic
1109111042 13:58318851-58318873 CGCCCACCGGCAACTCGCGCCGG + Intergenic
1109124726 13:58504542-58504564 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1109124947 13:58505736-58505758 CACCCACCCGGAACTCACGCTGG + Intergenic
1109141020 13:58714128-58714150 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1109145383 13:58773362-58773384 TGCCCACCCAGAACTCACGCTGG - Intergenic
1109159899 13:58958498-58958520 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1109364611 13:61339212-61339234 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1109441339 13:62379271-62379293 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1109446638 13:62448214-62448236 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1109506128 13:63305792-63305814 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1109563185 13:64077810-64077832 CACCCACCCGGAACTCGCGCTGG + Intergenic
1109741506 13:66561110-66561132 CGGCCACCCGGAACTCGCGCTGG - Intronic
1109745791 13:66621993-66622015 CGCCCACCCGGAACTCCAGCTGG - Intronic
1109829975 13:67773237-67773259 CACCCACCCGGAACTCGAGCTGG + Intergenic
1109854327 13:68108032-68108054 CGCCCACCTGGAACTTGCGCTGG + Intergenic
1109884356 13:68523987-68524009 CGTCCACCTGGAACTCACGCTGG - Intergenic
1110024095 13:70512221-70512243 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1110368838 13:74718436-74718458 CGGCCACCCAGAACTCCAGCTGG - Intergenic
1110417461 13:75268493-75268515 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1110497836 13:76190149-76190171 CGCCCACCCGGAACTCACGCTGG - Intergenic
1110609839 13:77475770-77475792 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1110751421 13:79119936-79119958 CACCCACCTGGAACTCCCGCTGG + Intergenic
1110792423 13:79600474-79600496 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1110854227 13:80278935-80278957 CGCCCACCCGGAACTCGTGCTGG + Intergenic
1110862106 13:80355591-80355613 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1110913956 13:80998744-80998766 CGCCCACCCAGAACTCACGCTGG + Intergenic
1110940325 13:81341086-81341108 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1110999869 13:82165266-82165288 CACCCACCCGGAATTCCAGCTGG + Intergenic
1111138808 13:84086692-84086714 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1111220881 13:85204958-85204980 CACCCACCCAGAACTCGCGCTGG - Intergenic
1111333543 13:86792309-86792331 CCCCCAACCGGAACTCGCGCTGG - Intergenic
1111441879 13:88291864-88291886 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1111445921 13:88345738-88345760 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1111556198 13:89884142-89884164 CGCCCACCCGGAACTCGCACTGG + Intergenic
1111590997 13:90348645-90348667 CGCCCACCCGGAACTGCAGCTGG - Intergenic
1111602705 13:90494864-90494886 TGCCTACCCGGAACTCCAGCTGG - Intergenic
1111747661 13:92290933-92290955 GGCCCACCCAGAACTCACGCTGG - Intronic
1111748299 13:92296710-92296732 CGCCCACACGGAACTCCAGCTGG - Intronic
1111841441 13:93455101-93455123 CGCCCACCCGGAACTCCAGCTGG + Intronic
1112077782 13:95931752-95931774 CGCCCACCCGGAACTCGCGCTGG + Intronic
1112226472 13:97545321-97545343 CGCCGACTGGGAACTCCAGCTGG - Intergenic
1112518616 13:100077560-100077582 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1112533196 13:100224365-100224387 CGCCCACCCGGAACTCCAGCTGG + Intronic
1112538248 13:100282491-100282513 CGCCCACCTGGAACTCCAGCTGG - Intronic
1112613068 13:100975741-100975763 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1112705827 13:102068519-102068541 TGCCCACCCGGAACTCCAGCTGG - Intronic
1112842675 13:103600026-103600048 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1113371980 13:109732970-109732992 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1113482712 13:110633345-110633367 CGCCCACCCGGAACTCCAGCTGG + Intronic
1113506612 13:110821204-110821226 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1113538161 13:111084188-111084210 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1113678029 13:112221761-112221783 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1114560336 14:23585198-23585220 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1114593507 14:23891801-23891823 CGCCTACCCGGAACTCCAGCTGG - Intergenic
1114679554 14:24473194-24473216 CGCCCACCCGGAACTCACACTGG - Intergenic
1115174620 14:30547833-30547855 CGCCCACCCGGAACTCGCATTGG + Intergenic
1115268658 14:31527401-31527423 CGCCCACCCGGAGCTCGCGCTGG + Intronic
1115284227 14:31700590-31700612 CGCCCACCCGGAACTCGCGCTGG - Intronic
1115421378 14:33199055-33199077 CGCCCACCTGGAACTTGCGCTGG + Intronic
1116114523 14:40629954-40629976 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1116152154 14:41154555-41154577 CGCCCATCCGGAACTCGCGCTGG + Intergenic
1116223216 14:42113781-42113803 CGGCCACCCGGAACTCGCGCTGG + Intergenic
1116251058 14:42482705-42482727 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1116310983 14:43326649-43326671 CGCCCACCCAGGACTCACGCTGG - Intergenic
1116325780 14:43533074-43533096 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1116426496 14:44798634-44798656 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1116437573 14:44912214-44912236 CGCCCACCCGGAACCGGCGCCGG - Intergenic
1116452332 14:45080481-45080503 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1116594356 14:46820479-46820501 CGCCCACCCGGAACTCTAGTTGG - Intergenic
1116653750 14:47626602-47626624 CGCCCACCCGGAACTCGCGCTGG - Intronic
1116656935 14:47665576-47665598 CGCCCACCCGGAACTCCAGCTGG - Intronic
1117077841 14:52122288-52122310 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1117082569 14:52166791-52166813 CGCCCACCTGGACCTCACGCTGG - Intergenic
1117297546 14:54393499-54393521 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1117297752 14:54394663-54394685 CGCCCACCCAGAACTCGCGCTGG + Intergenic
1117302482 14:54443096-54443118 CGCCAACCCGGAACTCCAGCTGG - Intergenic
1117449791 14:55839553-55839575 CGCCCACCTGGAACTCGCGCTGG - Intergenic
1117565613 14:56991091-56991113 CACCCACCCGGAACTCGTGCTGG - Intergenic
1117571952 14:57056931-57056953 CGCCCACCGGGAACTCCAGCTGG + Intergenic
1117727362 14:58687569-58687591 CGCCCACCTGGAACTCATGCTGG + Intergenic
1117742600 14:58833964-58833986 CGCCCACCCGGAACTGGCGCTGG - Intergenic
1118215395 14:63803579-63803601 TGCCCGCCCGGAACTCCAGCTGG + Intergenic
1118306307 14:64658223-64658245 CGCCCACCAGGAACTCGCGCTGG - Intergenic
1118558929 14:67056995-67057017 CGCCCACCCAGAACTCGTGCTGG + Intronic
1118932341 14:70254765-70254787 CGCCTACCCGGAACTCGCACTGG - Intergenic
1119027758 14:71167584-71167606 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1119038813 14:71254340-71254362 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1119300347 14:73566649-73566671 TGCCCACCTGGAACTCCAGCTGG + Intergenic
1119303699 14:73590749-73590771 CGCCCACCCGGGACTCGCGCTGG + Intergenic
1119486752 14:74994193-74994215 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1119673477 14:76537066-76537088 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1119695075 14:76706980-76707002 CGCCTACCCGGAACTCGGGCTGG + Intergenic
1119870727 14:78014297-78014319 AGCCCACTCGAAACTCCAGCTGG + Intergenic
1120209896 14:81624081-81624103 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1120330954 14:83092429-83092451 CGCCTACCTGGAACTCCAGCTGG - Intergenic
1120429779 14:84399680-84399702 CGCTCACCCGGAACTCGAGCTGG + Intergenic
1120439138 14:84513224-84513246 CACCCACCCAGAACTCCAGCTGG + Intergenic
1120632334 14:86905746-86905768 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1120844135 14:89111692-89111714 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1121350678 14:93170399-93170421 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1122216557 14:100208474-100208496 CGCCCACCCGGAACTCTATCTGG + Intergenic
1122434954 14:101689126-101689148 CGCCCACCTGGAACTCGTGCTGG - Intergenic
1122493485 14:102135826-102135848 CGCCCACCCGGAACTCCAGCTGG + Intronic
1123051856 14:105547875-105547897 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1123799113 15:23802958-23802980 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1123825594 15:24078747-24078769 CGCCCACCCAGAACTCGCACTGG + Intergenic
1123949159 15:25253509-25253531 CACCCACCCGGAACTCCAGCTGG + Intergenic
1124036346 15:26056957-26056979 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1124061611 15:26298378-26298400 CGCCCACCCGGAACTCGTGTTGG + Intergenic
1124110620 15:26781942-26781964 CGCCCACCCAGGACTCACGCTGG + Intronic
1124114886 15:26831495-26831517 CGCCCACCCGGAACTCCAGCTGG + Intronic
1124198604 15:27656719-27656741 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1124380371 15:29160192-29160214 CGCCCACTTGGAACTCCTGCTGG + Intronic
1124387869 15:29225062-29225084 TGCCCACCCAGAACTCACGCTGG + Intronic
1124573100 15:30883801-30883823 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1125112187 15:36046999-36047021 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1125480319 15:40075089-40075111 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1125565779 15:40677243-40677265 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1125609675 15:40961662-40961684 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1125885570 15:43226864-43226886 CGCCCACCGGGAACTCTAGCTGG + Intergenic
1125914580 15:43474194-43474216 CACCCACCAGGAACTCCAGCTGG + Intronic
1126088964 15:45034879-45034901 CGCCTACCCGGAACTCCAGCTGG - Intronic
1126128048 15:45314137-45314159 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1126165554 15:45651320-45651342 CGCCCACCCAGAACTCGTGCTGG + Intronic
1126639648 15:50812013-50812035 CACCCACCCGGAACTCGTGCTGG - Intergenic
1126997556 15:54462500-54462522 CGCCCACCCAGAACTGGCGCTGG - Intronic
1127766092 15:62186877-62186899 CGCCCACTGGGAACTCTAGCTGG + Intergenic
1127916414 15:63459111-63459133 CGCCCACCCGGAACACCCGCTGG - Intergenic
1127984750 15:64060928-64060950 CACCCACCCGGAACTCGCGCTGG - Intronic
1128110819 15:65075069-65075091 CGCCCACCTGGAACTCCAGCTGG - Intronic
1128141082 15:65301389-65301411 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1128594118 15:68929202-68929224 CGCCCACCCGGAACTCGGGCTGG + Intronic
1128598599 15:68975985-68976007 TGCCCACCCAGAACTCCAGCTGG + Intronic
1128670003 15:69567672-69567694 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1128813337 15:70587490-70587512 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1129158289 15:73732462-73732484 CGCCCGCCCGGAACTCGCGCTGG + Intergenic
1129196910 15:73973793-73973815 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1129208613 15:74052583-74052605 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1129280421 15:74480660-74480682 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1129374029 15:75116262-75116284 CGCCCACCCGGAACTCGCGCTGG + Intronic
1129674208 15:77623571-77623593 CGCCCAGGCTGAGCTCCTGCAGG + Intronic
1129724415 15:77894288-77894310 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1129777526 15:78246453-78246475 CGCCCACCCGGAACTACAGCTGG + Intergenic
1129859140 15:78846918-78846940 CGCCCATCTGGAACTCCAGCTGG - Intronic
1129986876 15:79926158-79926180 CACCCACCCGGAACTCGCGCTGG - Intergenic
1129997126 15:80016566-80016588 CGCCCACCCGGAACTCACGCTGG - Intergenic
1130132834 15:81158667-81158689 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1131005000 15:88970904-88970926 CACCCACCCAGAACTCGCGCTGG + Intergenic
1131012729 15:89031969-89031991 TGCCCACCCGGAACTCGCGCTGG + Intergenic
1131212669 15:90511004-90511026 CGCCCACCCGGAACTCACGCTGG - Intergenic
1131472850 15:92711333-92711355 CGCCCACCCGGAACTCGCGCTGG + Intronic
1131507762 15:93031872-93031894 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1131846148 15:96492153-96492175 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1131892195 15:96984425-96984447 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1131912565 15:97224292-97224314 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1131969282 15:97875783-97875805 CGCCCACCCGGAACCCGCGCCGG - Intergenic
1131992403 15:98104539-98104561 GGCCCACCCGGAACTCGCGCTGG + Intergenic
1132044194 15:98549799-98549821 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1132097683 15:99000094-99000116 CGCCCACCCGGAATTCGCGCTGG - Intronic
1132098890 15:99008551-99008573 CGCCCACCCGGAACTCGCACTGG + Intergenic
1132510990 16:341308-341330 CGCCCACCCGGGACTCCAGCTGG - Intronic
1133352182 16:5108826-5108848 CGCCCAGCCGGCACTCGCGCTGG + Intergenic
1133814291 16:9184477-9184499 CGCCCACCTGGAACTTGCGCTGG + Intergenic
1134290901 16:12902267-12902289 CGCCCACGCCGGACTTCTGCCGG + Exonic
1134678159 16:16104942-16104964 CGCCCACCCAGAACTAGCGCTGG + Intronic
1135262151 16:20989956-20989978 CGCCCACCCGGAACTCCAGCTGG + Intronic
1135280822 16:21152642-21152664 CGCCCACCCGGAACTCCAGCTGG - Intronic
1135299418 16:21313096-21313118 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1135338975 16:21630291-21630313 CGCCCACCCGGAACCCACGCTGG + Intronic
1135470230 16:22723257-22723279 CGCCTACCTGGAACTCGCGCTGG + Intergenic
1135751096 16:25059226-25059248 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1135942714 16:26836370-26836392 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1136163270 16:28435414-28435436 CGCCCACTCGGACCTCCAGCTGG - Intergenic
1136199696 16:28679573-28679595 CGCCCACTCGGACCTCCAGCTGG + Intergenic
1136216043 16:28793746-28793768 CGCCCACTCGGACCTCCAGCTGG + Intergenic
1136356619 16:29748402-29748424 CGCCCACCCGGAACTCATGCTGG - Intergenic
1136400038 16:30011931-30011953 AGCCCATGGGGAACTACCGCAGG - Intronic
1137442488 16:48508751-48508773 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1138561381 16:57802626-57802648 CGCCCCCGCAGGTCTCCCGCCGG + Intronic
1138688748 16:58748895-58748917 CGCCCACCTGGAACTCTAGCTGG - Intergenic
1139018994 16:62724912-62724934 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1139051456 16:63129679-63129701 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1139088542 16:63617450-63617472 CGCCCACCCGGAACCCGTGCCGG + Intergenic
1139147706 16:64343940-64343962 CGCCTACCCGGAACTCCAGCTGG - Intergenic
1139442288 16:66974325-66974347 CGCCCACCCGGAACTCACTCTGG - Exonic
1139600277 16:67982321-67982343 CGCCCACCCGGAACTCGAGCTGG - Intergenic
1139603022 16:67998260-67998282 CGCCCACCCGAAACTCCAGCTGG - Intronic
1139676400 16:68526793-68526815 CACCCACCCGGAACTCGCGCTGG - Intergenic
1140722550 16:77784693-77784715 CGCCCACCAGGAACTCCAGCTGG + Intergenic
1141430386 16:83968124-83968146 CGCCCATCCTTAACTCCCGCGGG - Intergenic
1141465764 16:84204897-84204919 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1141837685 16:86553474-86553496 CGCCTACATGGAACTCGCGCTGG - Intronic
1142505643 17:361638-361660 CGCCCACCCGGAACTCCAGCTGG - Intronic
1142828834 17:2532412-2532434 CGCCCACCCGGAACTCATGCTGG + Intergenic
1143128009 17:4656824-4656846 CGCCCACCCGGAACTCACGCTGG + Intergenic
1143135285 17:4709356-4709378 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1143283335 17:5771289-5771311 CGCCCACCCGGAATTCGCGCTGG - Intergenic
1143460532 17:7100871-7100893 CGCCCACCCGGAAATCGCGCTGG + Intergenic
1143664303 17:8347435-8347457 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1144128059 17:12220950-12220972 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1144467129 17:15505742-15505764 CGCCCACCCGGAACTCCAGCTGG - Intronic
1144723187 17:17486398-17486420 CGCCCAGCCGGAACTCCAGCTGG - Intronic
1144804688 17:17956786-17956808 CGCCCACCCAGAACTCGCGCTGG + Intronic
1145050334 17:19654631-19654653 CGCCCACCCAGAACTCGCTCTGG + Intronic
1145094816 17:20016511-20016533 CGCCCACCGGGAACTCACGCTGG - Intronic
1146740495 17:35279229-35279251 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1147373596 17:40010978-40011000 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1147431795 17:40375873-40375895 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1147805319 17:43126885-43126907 CGCCCACCTGGAACTCGCGCTGG - Intergenic
1147997505 17:44368868-44368890 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1148016841 17:44528010-44528032 CGCCCACCCGGACATCCAGCTGG - Intergenic
1148023354 17:44568262-44568284 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1148366206 17:47057598-47057620 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1148991227 17:51668817-51668839 CGCCCACCCAGAACTCGCGCTGG - Intronic
1149753951 17:59172569-59172591 CGCCCACCCAGAACTCAAGCTGG - Intronic
1149775434 17:59353354-59353376 AGCCCACGAGGCACTCCCACAGG - Exonic
1149916362 17:60613659-60613681 TGCCCACCTGGAACTCGCGCTGG - Intronic
1150682486 17:67294795-67294817 CGCACACCCGGAACTCGCGCTGG - Intergenic
1150772254 17:68051918-68051940 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1150775799 17:68080702-68080724 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1150778251 17:68099328-68099350 GGCCCACCCGGAACTCCAGCTGG - Intergenic
1150786773 17:68169672-68169694 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1150788238 17:68179893-68179915 CGCCCACCTGGAACTCTAGCTGG - Intergenic
1150792220 17:68207903-68207925 CACCCACTGGGAACTCACGCTGG - Intergenic
1150804635 17:68309225-68309247 CGCCCACCCGGAACTCCAGCTGG + Intronic
1151567491 17:74907357-74907379 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1151705585 17:75765284-75765306 CCCCCACCCGCAACTCCCGTGGG + Exonic
1151782704 17:76257964-76257986 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1151840670 17:76615225-76615247 CGCCCATCCAGCACTCCCGCTGG + Intergenic
1152619078 17:81352357-81352379 AGCCCACGCGGAACTCCAGCTGG + Intergenic
1153070352 18:1098271-1098293 CGCCCACCCGGAACTCGCGTTGG - Intergenic
1153644084 18:7178981-7179003 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1153768955 18:8400405-8400427 CGCCCACCCCCAACTCCCGGGGG + Intronic
1153832491 18:8935738-8935760 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1154057269 18:11023961-11023983 CGCCCACCCGTAACTCCAGCTGG + Intronic
1154128778 18:11717227-11717249 CGCCCACCCGGAAGTCACACTGG + Intronic
1154231457 18:12559402-12559424 CACCCACCCGGAACTCGTGCTGG + Intronic
1154255344 18:12777169-12777191 TGCCCACCCGGAACTCTAGCTGG + Intergenic
1154294136 18:13134984-13135006 CGCCCACCCGGAACGCGTGCTGG + Intergenic
1154942976 18:21132771-21132793 CGCCCATCCGGAACTCTAGCTGG + Intergenic
1154954366 18:21241209-21241231 CGCACACGGGGAGCTCCCCCGGG + Intergenic
1155003292 18:21706563-21706585 CACCCACCCGGAACTCCCGCTGG - Intronic
1155208079 18:23577946-23577968 CGCCCACCCGGAACTCCAGCTGG + Intronic
1155271984 18:24149869-24149891 TGCCCACTCGGAACTCCAGCTGG + Intronic
1155295063 18:24376901-24376923 CGCCCACACGGAACTCCAGCCGG + Intronic
1155611737 18:27674178-27674200 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1155806329 18:30175433-30175455 CACCCACCCGGAACTCGCGCTGG + Intergenic
1155852256 18:30788489-30788511 TGCCCAACCGGAACTCCAGCTGG - Intergenic
1155856404 18:30839473-30839495 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1155976757 18:32139910-32139932 CGCCCACCCGGAACTCACGCTGG - Intronic
1156038641 18:32794620-32794642 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1156118959 18:33820240-33820262 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156118971 18:33820268-33820290 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156118983 18:33820296-33820318 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156118995 18:33820324-33820346 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119007 18:33820352-33820374 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119019 18:33820380-33820402 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119031 18:33820408-33820430 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119043 18:33820436-33820458 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119055 18:33820464-33820486 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119067 18:33820492-33820514 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119079 18:33820520-33820542 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156119091 18:33820548-33820570 CGCCCACCCGGAACCCGCGCCGG + Intergenic
1156150319 18:34234003-34234025 CGCCCACCTGGAACTGGCGCTGG - Intergenic
1156243071 18:35271962-35271984 CGCCCACCCGGAACTCGCGCTGG + Intronic
1156610515 18:38718699-38718721 CGCCCACCCGGAACTTGCGCTGG + Intergenic
1156657802 18:39309138-39309160 CGCCCACCCGCAACTCATGCTGG - Intergenic
1156863630 18:41865802-41865824 TGCCCACCTGGAACTCCAGCTGG - Intergenic
1156943147 18:42795293-42795315 CGCCCACCCGGAACTCCAGCTGG - Intronic
1156969647 18:43139567-43139589 TGCCCACCCGGAACTCTAGCTGG - Intergenic
1157085942 18:44580778-44580800 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1157856924 18:51112120-51112142 CACCCACCCGGAACTTGCGCTGG + Intergenic
1157858395 18:51121233-51121255 CCCCCACCCGGAACTCACGCTGG + Intergenic
1157935206 18:51864685-51864707 TGCCCACCCGGAACTCGCGCTGG + Intergenic
1157979827 18:52367219-52367241 CGCCCACCCGGAACTCCAGCTGG + Intronic
1158266412 18:55664936-55664958 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1158351890 18:56572335-56572357 CGCCTACCCGGAACTCCAGCTGG - Intergenic
1158460755 18:57643929-57643951 CGCCTACCCAGAACTCACGCTGG + Intergenic
1158597359 18:58827996-58828018 CGCCCACCCGGAACTCATGCTGG + Intergenic
1158697289 18:59714407-59714429 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1158705781 18:59790766-59790788 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1159167980 18:64725945-64725967 CGCCCATCCGGAACTCCAGCTGG + Intergenic
1159230767 18:65605299-65605321 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1159260510 18:66006270-66006292 CGCCCACCCGGAACTCGCACTGG + Intergenic
1159289295 18:66395867-66395889 CGGCCACCCGGAACTCGCGCTGG - Intergenic
1159322197 18:66866745-66866767 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1159472977 18:68880310-68880332 TGCCCACCCGGAACTCCAGCTGG + Intronic
1159656134 18:71031654-71031676 CCCCCACCTGGAACTCCAGCTGG + Intergenic
1159670235 18:71212795-71212817 CGCCCACGAAGAACTCGCGTTGG + Intergenic
1159743931 18:72209170-72209192 CGCCCATCCGGAACTCTAGCTGG - Intergenic
1160176650 18:76600445-76600467 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1160198525 18:76777290-76777312 CGCCCACCCAGAAGTCCAGCCGG - Intergenic
1160200091 18:76788848-76788870 CGCCCACTCGGAACTCGCGCTGG + Intergenic
1162106971 19:8375805-8375827 CGCCCACCCGGAACTCCAGCTGG - Intronic
1162230116 19:9259559-9259581 CGCCCACCCGGAACTCCAGCGGG - Intergenic
1162233141 19:9283769-9283791 CGCCCACCCGGAACTCCAGCCGG + Intergenic
1162237621 19:9321443-9321465 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1162262075 19:9541639-9541661 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1162632728 19:11941610-11941632 CGCCCACCCAGAACTCCAGCTGG + Intronic
1162814758 19:13187024-13187046 CGCCCACCCGGAACTCCAGCCGG + Intergenic
1162987078 19:14277671-14277693 CACCCACCTGGAACTCACGCTGG - Intergenic
1163152797 19:15424934-15424956 CGGTCACGCCGAACTGCCGCAGG + Exonic
1163181750 19:15608960-15608982 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1163218819 19:15899728-15899750 CGCCCACCTGGAACTCTAGCTGG - Intergenic
1164144053 19:22499304-22499326 CGCCGACCCGGAACTCCAGCTGG + Intronic
1164270617 19:23668842-23668864 CGCCCACCCGGAACTCCAGCTGG + Intronic
1164310432 19:24041359-24041381 CGCCCACCCGGAACTCCAGCTGG - Intronic
1164581945 19:29440065-29440087 AGCCCACCTGGAACTCACGCTGG - Intergenic
1164975766 19:32571633-32571655 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1165266909 19:34668239-34668261 CGCCCACCGGGAACTCCAGCTGG - Intronic
1165846559 19:38821542-38821564 CACCCACCCGGAACTTGCGCTGG - Intronic
1166036251 19:40170456-40170478 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166147687 19:40848683-40848705 TGCCCACCCCGAAGTCCCGCAGG + Exonic
1166170723 19:41026077-41026099 TGCCCACCCCGAAGTCCCGCAGG + Intergenic
1166487039 19:43222247-43222269 CGCCCACCCGGAACTCCAGCTGG + Intronic
1166649752 19:44563520-44563542 CGCCCATCCGGAACTCCAGCTGG + Intergenic
1168327137 19:55544225-55544247 GGCCCACACAGAACTCCCTCAGG + Exonic
1168659857 19:58157348-58157370 CGCCCATCCGGAACTCTAGCTGG - Intergenic
924967354 2:91037-91059 CGCCCACCCAGAACTCACGCTGG - Intergenic
925098999 2:1229910-1229932 CGCCCACCCGGAACTCCAGCTGG + Intronic
925172624 2:1759611-1759633 CGCCCACCCAGAACTTGCGCTGG + Intergenic
925537835 2:4935629-4935651 CGCCCACCCGGAACTCCAGCTGG + Intergenic
926083396 2:10006498-10006520 CGTCCACCCGGAACCCGCGCCGG + Intergenic
926444555 2:12926825-12926847 CGCCCACCCGGAACTCGCGCTGG + Intergenic
926474797 2:13308606-13308628 CGCCCAGCCGGAACTCGCGCTGG + Intergenic
926616662 2:15002850-15002872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
926685850 2:15697045-15697067 CGCCCACCTGGAACTCGCGCTGG + Intronic
926850642 2:17193599-17193621 CGCCCACCCGGAACTCGCGCTGG - Intergenic
927357053 2:22186388-22186410 CGCTCACCCGGAACTCGCGCTGG - Intergenic
927777780 2:25915546-25915568 CGCCCACCCGGAACTCGCGCTGG - Intergenic
927900404 2:26814515-26814537 CGCCTACCCGGAACTCGCTCTGG - Intergenic
927942213 2:27111782-27111804 CGCCCACCCGGAACTCGCGCTGG + Intronic
928493058 2:31803764-31803786 CGCCCACCCGGAACTCCAGCTGG - Intergenic
928753166 2:34494338-34494360 CACCCACCCGGAACTCCAGCTGG - Intergenic
928793843 2:34992095-34992117 TGCCCACCCGGAACCCGCGCTGG - Intergenic
928936867 2:36688306-36688328 CGCCCACCCGGAACTCCAGCTGG - Intergenic
929070028 2:38020557-38020579 CGCCCACCCGGAACTCCAGCTGG - Intronic
929109848 2:38397356-38397378 TGCCCACCCGGAACTCGCGCTGG - Intergenic
929138046 2:38643376-38643398 CGCCCACCTGGAACTCGCGCTGG + Intergenic
929201830 2:39244320-39244342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
929233686 2:39585411-39585433 CGCCCACCCGGAACTCCAGCTGG - Intergenic
929379658 2:41335635-41335657 CGCCCACCTGGAACTCCAGCTGG - Intergenic
929890902 2:45917989-45918011 CGCCCACCCGGAACTCTAGCTGG + Intronic
930037986 2:47099777-47099799 TGCCCACCCGGAACTCCAGCTGG - Intronic
930039183 2:47107325-47107347 TGCCCACCCGGAACTCCAGCTGG - Intronic
930420909 2:51151934-51151956 CGCCCACTCGGAACGCCCGCTGG + Intergenic
930468243 2:51780601-51780623 CGCCCATCCGGAACTCCAGCTGG + Intergenic
930485478 2:52006844-52006866 CGCCCACCCGGAACTCCAGCTGG - Intergenic
931708665 2:64969049-64969071 CGCCCACCCGTATCTCCAGCTGG - Intergenic
932112342 2:69012973-69012995 CGCCCCCGACGCACTCCCGCGGG + Intergenic
932178257 2:69622128-69622150 CGCCCACCTGGAACTGGCGCTGG - Intronic
932239904 2:70148350-70148372 CGCCCACCGGGAACTCCAGCTGG - Intergenic
932359547 2:71092802-71092824 CGCCTACCCGGAACTCCAGCTGG + Intergenic
932486446 2:72086926-72086948 CGCCCACCGGGAACTCCAGCTGG - Intergenic
932521748 2:72421873-72421895 TGCCCACCCGGAACTCCAGCTGG - Intronic
932902021 2:75711620-75711642 TGCCCACCCGGAACTCCAGCTGG - Intergenic
933060862 2:77735069-77735091 CGCCCACCGGGAACTCGCGCTGG + Intergenic
933139779 2:78779039-78779061 CGCCCACCGGGAGCTCGCGCTGG - Intergenic
933442101 2:82326521-82326543 CGCCCACCCGGAACTCGTGCTGG + Intergenic
933487286 2:82938760-82938782 CGCCCACCCAGAACTCCAGCTGG + Intergenic
933511492 2:83246241-83246263 CGCCCACCCGGAACTCACGCTGG + Intergenic
933531611 2:83518215-83518237 CGCCCACCCGGAACTCGCGCTGG - Intergenic
933712169 2:85334666-85334688 CGTCCACCCGGAACTCGCGCTGG + Intergenic
934085101 2:88503183-88503205 CGCCCACCCAGAACTCGCGCTGG - Intergenic
934858070 2:97741331-97741353 CGCCCACGCGGACTCCCCTCTGG + Intergenic
934898465 2:98139048-98139070 CAGCCACCCGGAACTCCAGCTGG - Intronic
935878385 2:107536404-107536426 TGCCCACCAGGAACTCACGCTGG + Intergenic
935896884 2:107747654-107747676 CGCCCACCCGGAACTCCAGCTGG + Intergenic
935922528 2:108031609-108031631 CGCCCACCTGGAACTTGCGCTGG - Intergenic
936172725 2:110190508-110190530 CGCCCACCCGGAACTCACGCTGG + Intronic
936346858 2:111681895-111681917 CGCCCACCCGGAACTCCAGCTGG - Intergenic
936581553 2:113704720-113704742 CACCCACCCAGAACTCGCGCTGG + Intergenic
937181111 2:119997028-119997050 CACCCACCCAGAACTCGCGCTGG - Intergenic
937209623 2:120260066-120260088 CGCCCACCCGGAACTCCAGCTGG + Intronic
937596824 2:123683818-123683840 CACCCACCCAGAACTCCAGCTGG - Intergenic
937608228 2:123827059-123827081 CGCCCACATGGAACTCGCCCTGG + Intergenic
937711877 2:124987726-124987748 CGCCCACCCGGAACTCCAGCTGG + Intergenic
937746572 2:125422291-125422313 CACCCACCCAGAACTCCAGCTGG - Intergenic
937751455 2:125479477-125479499 CGGCCACCTGGAACTCACGCTGG + Intergenic
937789454 2:125943240-125943262 TGCCCACCTGGAACTCACGCTGG + Intergenic
938126107 2:128672440-128672462 CGCCCACCCGGAGCTCTAGCTGG + Intergenic
938512595 2:131966483-131966505 CGCCCACCCGGACCCCACGCCGG - Intergenic
938726058 2:134109664-134109686 CGCCCACCCAGAACTCTAGCTGG + Intergenic
938728749 2:134129983-134130005 CGCCCACCTGGAACTTGCGCTGG - Intronic
938931229 2:136088338-136088360 CGCCCACCTGGAACTCGCGCTGG + Intergenic
939003112 2:136758506-136758528 CGCCCACTCGGAACTTGAGCTGG - Intergenic
939053245 2:137331922-137331944 CGCCCACCCGGAATTCCAGCTGG + Intronic
939229728 2:139410386-139410408 CGCCCACCCGGAACTCCAGCTGG - Intergenic
939281725 2:140073835-140073857 CGCCCACCTGGAACTCCAGCTGG - Intergenic
939465099 2:142546106-142546128 CGCCCACCCGGAACTCCAGCTGG - Intergenic
939738809 2:145881224-145881246 TGCCCACCCTGAACTCCAGCTGG + Intergenic
939869032 2:147506966-147506988 CACCCACCTGGAACTCGCGCTGG - Intergenic
939898883 2:147826906-147826928 CGCCCACCCGGAACTCTGGCTGG - Intergenic
939972565 2:148678703-148678725 CGCCCACCTGGAACTCCAGCTGG + Intronic
940038192 2:149331073-149331095 CGTCCACCAGGAACTCCAGCCGG + Intronic
940112673 2:150171342-150171364 CGCCCACCCGGAACTCGCGCTGG + Intergenic
940361963 2:152805136-152805158 CGCCCACCCGGAACTTGCGCTGG + Intergenic
940666736 2:156618373-156618395 CGCCCACCCGGAACTCCAGCTGG + Intergenic
940784626 2:157968186-157968208 TGCCCACCTGGAACTCGCGCTGG + Intronic
941178868 2:162234904-162234926 CGCCCACCCAGAACTCTAGCTGG - Intronic
941240054 2:163026320-163026342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
941309757 2:163913659-163913681 CGCCCACCCGGAACTCCAGCTGG - Intergenic
941397961 2:164995070-164995092 CGCCCACCAGGAACTCCAGCTGG + Intergenic
941476618 2:165957383-165957405 CGCCCACCTGGAACTCGCGCGGG + Intergenic
941705900 2:168657754-168657776 CGCCCACCCGGAACTCCAGCTGG + Intronic
941712151 2:168725213-168725235 CGCCCACCCGGAACTCCAGCTGG + Intronic
941820763 2:169841578-169841600 CGCCCACCCGGAACTCCAGCTGG - Intronic
941878630 2:170459940-170459962 CCCCCACCCGGAACTCATGCTGG + Intronic
942170282 2:173282903-173282925 CGCCCACCCAGAACTCACGCTGG + Intergenic
942317624 2:174709883-174709905 CGCCCGCCCAGAACTCCAGCTGG + Intergenic
942368694 2:175257318-175257340 CACCCACCCGGAACTCGCGCTGG + Intergenic
942867258 2:180691432-180691454 CGCCCACCTGGAACTCCAGCTGG - Intergenic
943024201 2:182608505-182608527 CGCCCACCCGGAACTCGCGCTGG - Intergenic
943106180 2:183546961-183546983 CGCCCACCCGGAACTCGTGCTGG + Intergenic
943134410 2:183892579-183892601 CGCCCACCCGGAACTCACACTGG - Intergenic
943166098 2:184327968-184327990 CGCCCACCCGGAACTCGCACTGG + Intergenic
943443264 2:187951759-187951781 CGCCCACCTGGAACTCGCACTGG - Intergenic
943494784 2:188606709-188606731 CGCCCACCCGGAACTCCAGCTGG + Intergenic
943680379 2:190761279-190761301 CGCCCACCCGGAACTCCAGCTGG + Intergenic
943835132 2:192508013-192508035 TGCCCACCTGGAACTCCAGCTGG - Intergenic
943906143 2:193502724-193502746 CGCCCACCCGGAACTGGTGCTGG + Intergenic
943941463 2:194003053-194003075 CGCCCACACAGAACTAGCGCTGG + Intergenic
943942696 2:194020206-194020228 CGCCCACCTGGAACTTGCGCTGG - Intergenic
943954890 2:194176358-194176380 CGCCCACCCAGAACTCTAGCTGG - Intergenic
944055169 2:195515724-195515746 CGCCCACCCGGAACTCGCGCTGG - Intergenic
944058512 2:195547627-195547649 CGCCCACCCGGAGCTGGCGCTGG + Intergenic
944228403 2:197370617-197370639 CGCCCACCCGGAACTCCAGCTGG - Intergenic
944482778 2:200174829-200174851 CGCCCACCCGGAACTGGCGCTGG - Intergenic
944688230 2:202136650-202136672 CGCCCACCCGGAACCCGCGCCGG + Intronic
944728569 2:202496955-202496977 TGCCCACCCGGAACTCCAGCTGG - Intronic
944729612 2:202503428-202503450 TGCCCAACCGGAACTCCGGCTGG - Intronic
944843161 2:203643143-203643165 CACCCACCTGGAACTCGCGCCGG + Intergenic
944857961 2:203785889-203785911 CGCCCACCCGGAACTCCAGCTGG + Intergenic
945069619 2:205977275-205977297 TGCCCACTGGGAACTCACGCTGG - Intergenic
945302588 2:208227999-208228021 CGCCCACCCGGAACTCGCACTGG + Intergenic
945401371 2:209387424-209387446 CGCCCACCCGGAACTCGCGCTGG - Intergenic
945451511 2:210000887-210000909 CGCCCACCTCGAACTCGCGCTGG + Intergenic
945575506 2:211524691-211524713 CGCCCACCCGGAACTCCAGCTGG + Intronic
945664248 2:212721382-212721404 TGCCCACCCGGAACTCGAGCTGG + Intergenic
945745753 2:213718536-213718558 CGCCCACCCGGAACTCCAGCTGG - Intronic
945869123 2:215207918-215207940 CGCCCACCTGGAATTCACGCTGG - Intergenic
945870190 2:215219103-215219125 CACCCACCCGGAACTCTAGCTGG - Intergenic
945872855 2:215246044-215246066 TGCCCACCCGGAACTCCAGCTGG + Intergenic
945907918 2:215615201-215615223 CGCCCACCCGGAACTTGCGCTGG + Intergenic
946053969 2:216885294-216885316 CGCCCACCCGGAACTCGCACTGG - Intergenic
946152794 2:217787571-217787593 CGCCCACCCAGAACTCACGCTGG + Intergenic
946358112 2:219201743-219201765 CGCCCACCTGGAACTCCAGCTGG + Intronic
946923596 2:224604017-224604039 CACCCACTCGGAACTCCAGCTGG + Intergenic
946929117 2:224655343-224655365 TGCACACCCGGAACTCGCGCTGG - Intergenic
946982198 2:225229764-225229786 CACCCTCCCGGAACTCCAGCTGG + Intergenic
947411964 2:229850763-229850785 CACCCACCCGGAACTCCAGCTGG - Intronic
947539378 2:230964551-230964573 CACCCACCCGGAACTCGCGCTGG + Intergenic
947720393 2:232366385-232366407 CGCCCACCCGGAACTCCAGCTGG - Intergenic
947932088 2:233972783-233972805 CGCCCACCCGGAACTCCATCTGG + Intronic
947938047 2:234024597-234024619 CGCCCACCCGGAACTCTAGTTGG + Intergenic
948449144 2:238058173-238058195 CGCCCACCCGGAACTCCAGCTGG + Intronic
948820071 2:240538326-240538348 CGCCCACCCAGAACTCGCGCTGG - Intronic
948845847 2:240682525-240682547 CGGCCATGAGGAACTCCTGCAGG + Exonic
948848011 2:240692205-240692227 CGGCCATGAGGAACTCCTGCAGG - Exonic
948910293 2:240999220-240999242 CGCCCGCGCGCCTCTCCCGCGGG - Intronic
1169814483 20:9641904-9641926 CGCCCACCCGGAACTCCAGCTGG + Intronic
1169849167 20:10031726-10031748 CGCCCACCCAGAACTCCAGCTGG - Intronic
1170230895 20:14045098-14045120 CGCCCACCTGGAACTTCGGCTGG + Intronic
1170246440 20:14226553-14226575 CGCCCACCCGGAACTCCAGCTGG - Intronic
1170649475 20:18226810-18226832 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1170806878 20:19639949-19639971 CGCCCACCCGGAACTCCAGCTGG + Intronic
1171318880 20:24221036-24221058 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1172431887 20:34899118-34899140 CGCCCACTCGGAACTCCAGCTGG + Intronic
1173195554 20:40910785-40910807 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1173195657 20:40911228-40911250 CGCCCACGCGGAACTCCAGCTGG - Intergenic
1173778738 20:45735942-45735964 CACCCACTCGGAACTCACGCTGG - Intergenic
1173831481 20:46091896-46091918 CGCCCACCTGGAACTCTAGCTGG - Intergenic
1174162907 20:48564378-48564400 CGCCCACCCGGAACTCACGCTGG + Intergenic
1175210037 20:57348441-57348463 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1175254123 20:57628839-57628861 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1176189358 20:63800608-63800630 CACCCACCCGGAACTCTAGCTGG - Intronic
1176344853 21:5733788-5733810 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1176351667 21:5854372-5854394 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1176499974 21:7590667-7590689 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1176539174 21:8131858-8131880 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1176549997 21:8216968-8216990 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1176558125 21:8314903-8314925 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1176568923 21:8400002-8400024 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1176576837 21:8444237-8444259 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1176663198 21:9660080-9660102 CGCCCACCTGGAACTCGCGCTGG - Intergenic
1176781168 21:13196312-13196334 CGCCCACCCGGACCCCACGCTGG + Intergenic
1176966646 21:15218891-15218913 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1177182418 21:17757902-17757924 CGCCCACCCAGAACTCGCACTGG + Intergenic
1177496902 21:21902462-21902484 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1177565857 21:22819155-22819177 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1177637589 21:23807062-23807084 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1177715989 21:24840398-24840420 GGCCCACCCGGAACCCGCGCCGG + Intergenic
1177795882 21:25778412-25778434 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1178074154 21:29000221-29000243 CGCCCACCCGGAACTCACGCTGG - Intergenic
1178082237 21:29077433-29077455 CGCCCACCCGGAACTCACGCTGG + Intergenic
1178398714 21:32265376-32265398 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1178585671 21:33868632-33868654 CGCCCACCCGGAACTCCAGCTGG + Intronic
1178922413 21:36747550-36747572 CGCCCACGCGCTGCACCCGCGGG - Intronic
1178983379 21:37283501-37283523 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1179718646 21:43302995-43303017 CACCCACCCGGCACTCCTGCAGG - Intergenic
1180741075 22:18053672-18053694 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1180755071 22:18155570-18155592 CGCCCACTCGGAACTCGCGCTGG - Intronic
1181077689 22:20392672-20392694 CGCCCACCCGGAACTCGTGCTGG + Intergenic
1181851462 22:25752856-25752878 CGACCACCCGGAACTCGCACTGG - Intronic
1182338049 22:29598337-29598359 CGCCCACCCGCAATTCGCGCTGG + Intergenic
1183071680 22:35400552-35400574 TGCCCACTCGGTACTGCCGCAGG - Exonic
1183422154 22:37718155-37718177 CGCCCACCCGGAACTCCAGCTGG + Intronic
1183685185 22:39357582-39357604 CGCCCACCCGGAACTCCAGCTGG - Intronic
1183990334 22:41593571-41593593 CGCCCACCCAGAACTCTAGCTGG - Intergenic
1184584230 22:45436773-45436795 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1184906278 22:47488622-47488644 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1185229155 22:49670515-49670537 CGCCCACCCGGAACTCGCGCCGG + Intergenic
1203244122 22_KI270733v1_random:48213-48235 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1203254887 22_KI270733v1_random:133294-133316 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1203262943 22_KI270733v1_random:178373-178395 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
949133624 3:536079-536101 CGCTCACCCGGAACCCACGCCGG + Intergenic
949258949 3:2083677-2083699 CGCCCACCACGAACTCCAGCTGG - Intergenic
949281465 3:2352437-2352459 CACCTACCCGGAACTCCAGCTGG - Intronic
949292728 3:2484955-2484977 CGGCCACCTGGAACTCGCGCTGG - Intronic
950203573 3:11061427-11061449 CGCCCACCTGGAACTCACGCTGG - Intergenic
950256681 3:11511911-11511933 CACCCACCCAGAACTCCAGCTGG + Intronic
950256990 3:11513558-11513580 CGCCCACCCGGAACTCCAGCTGG + Intronic
950418533 3:12882936-12882958 CGCCCACCCGGAACTCTAGCTGG - Intergenic
950470145 3:13179800-13179822 TGCCCACCCGGAACTCGCGCTGG - Intergenic
950513393 3:13447512-13447534 CACCCACCCGGAACTCCAGCTGG + Intergenic
950601203 3:14037243-14037265 TGCCCACCTGGAACTCGCGCTGG - Intronic
950632615 3:14293252-14293274 CGCCCACCCGGAACTCGTGCTGG - Intergenic
950929371 3:16773762-16773784 CGCCCACCCAGAACTCCAGCTGG - Intergenic
951146607 3:19234555-19234577 CGCCCACGCGGAACTCCCGCTGG + Intronic
951184947 3:19702616-19702638 CGCCCACCCGGAACTCGCGCTGG - Intergenic
951332970 3:21387525-21387547 CGCCCACCCAGAACTCATGCTGG + Intergenic
951734774 3:25851810-25851832 CGCCCACCTGGAACTCGCGCTGG - Intergenic
951951117 3:28200728-28200750 CGCCCACCCGGAACTCCAGCTGG + Intergenic
952011301 3:28903481-28903503 CACCCACCTGGAACTCGCGCTGG + Intergenic
952076289 3:29701622-29701644 CGCCCACCCAGAACTCACACAGG - Intronic
952275218 3:31870166-31870188 CGCCCACCTGGAACTCCAGCTGG - Intronic
952355360 3:32578799-32578821 CGCCCACCCGGAACTCCAGCTGG - Intergenic
952360442 3:32625684-32625706 CGCCCACCCGGAACTCCAGCTGG - Intergenic
952393683 3:32902839-32902861 CGCCCACCCAGAACTCCAGCTGG - Intergenic
952398205 3:32939728-32939750 CGCCCACCCAGAACTCCAGCTGG - Intergenic
952453668 3:33453494-33453516 CAACCACCCGGAACTCACGCTGG - Intergenic
952593608 3:34988409-34988431 CGCCCACCTGGAACTCCAGCTGG - Intergenic
952713290 3:36453390-36453412 CGCCCACCCGGAACTCACGCTGG - Intronic
952730611 3:36633952-36633974 CGCCCACCCGGAACTCCAGCTGG - Intergenic
953002862 3:38951197-38951219 CGCCCACCCGGAACTCCAGCTGG - Intergenic
953089797 3:39713361-39713383 CGCCCACCCAGAACTCCAGCTGG - Intergenic
953124540 3:40078240-40078262 CGCCCACCCGGAACTCCAGCTGG + Intronic
953307634 3:41844480-41844502 TGCCCACCCAGAACTCCAGCTGG + Intronic
953522520 3:43656741-43656763 CGCCCACCTGGAACTCCAGCTGG + Intronic
953674095 3:44986412-44986434 TGCCCACCCAGAACTCGCGCTGG + Intronic
953714577 3:45306714-45306736 CGCCCACCCAGAACTCTAGCTGG - Intergenic
954089354 3:48272238-48272260 CGCCCACCCGGAACTCATGCTGG + Intronic
954226216 3:49182931-49182953 TGCCCACCCGGAACTCACGCTGG + Intronic
954620095 3:51990602-51990624 CGCCCACCCGGAACTCCAGCTGG - Intergenic
955183321 3:56691925-56691947 CGCCCACACGGAACTCCAGCTGG - Intergenic
955186396 3:56718979-56719001 CGCCCACCCGGAACTCCAGGGGG - Intergenic
955210261 3:56934511-56934533 CACCCACCCGGAACTCCAGCTGG - Intronic
955219642 3:57012927-57012949 CACCCACCCGGAATTCACGCTGG - Intronic
955266486 3:57449661-57449683 CGCCCACCTGTAACTCCAGCTGG + Intronic
955449458 3:59050903-59050925 CGCCCACCCGGAACTCCAGCTGG - Intergenic
956183965 3:66544969-66544991 TGCCCACCCGGAACTCGCACTGG + Intergenic
956195720 3:66651616-66651638 CGCCCACCCGGAACTCGCGCTGG - Intergenic
956479597 3:69660712-69660734 TGCCCACCCGGAACTTGCGCTGG - Intergenic
956481432 3:69677498-69677520 CGCCCACCCGGAACTCCAGCTGG - Intergenic
956563610 3:70611901-70611923 CGCCCACCCGGAACTCGCGCTGG - Intergenic
956855232 3:73269238-73269260 CGCCCACCCGGAACTCCAGCTGG - Intergenic
956986945 3:74712102-74712124 CTCCCACCCGGAACTCCCGCTGG - Intergenic
957002290 3:74900249-74900271 CGCCCACCCGGAACTCGCGCTGG + Intergenic
957009213 3:74985441-74985463 CGCCCACCCAGAACTACAGCTGG + Intergenic
957056183 3:75444729-75444751 TGCCCACCCGGAACTCGCGCTGG + Intergenic
957074061 3:75587844-75587866 TGCCCACCTGGAACTCCAGCTGG - Intergenic
957209456 3:77240399-77240421 CGCCCACCCGGAACTCACGCTGG + Intronic
957270985 3:78029977-78029999 CGCCCACCTGGAACCTCCGCAGG - Intergenic
957277440 3:78108435-78108457 GGCCCACCCGGAACTCCATCTGG - Intergenic
957362052 3:79173383-79173405 CACCCACCTGGAACTCGCGCTGG - Intronic
957371457 3:79300264-79300286 CGCCCACCCGGAACTCCAGCTGG - Intronic
957386425 3:79502302-79502324 CGCCCACCCGGAACTCGCGCTGG - Intronic
957419698 3:79951686-79951708 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957446112 3:80314538-80314560 CGCCCACCCGAAACTCACGCTGG - Intergenic
957556326 3:81767702-81767724 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957630920 3:82715375-82715397 CGCCTACCCGGAACTCCAGCTGG - Intergenic
957665212 3:83217926-83217948 CGCCCACCCGGAACTCCAGCTGG + Intergenic
957804935 3:85134176-85134198 CGCCCACCCGGAACTCCAGCTGG + Intronic
957830047 3:85504991-85505013 CGCCCACCCGGAACTCCAGCTGG + Intronic
957921789 3:86757638-86757660 CGCCCACCCGGAACTCCAGCTGG - Intergenic
957995072 3:87679142-87679164 CGCCCACCTGGAACTTCAGCTGG - Intergenic
958022606 3:88015735-88015757 CGCCGACCCGGAACTCCAGCTGG - Intergenic
959422712 3:106148672-106148694 TGCCCACCTGGAACTCCAGCTGG - Intergenic
960227562 3:115185200-115185222 CACCCACCCGGAACTCCAGCTGG + Intergenic
960282109 3:115791607-115791629 CGCCCACCCGGAACTCCAGCTGG - Intergenic
960479517 3:118171443-118171465 CGCCCACCCGGAACTCGCGGTGG - Intergenic
960487292 3:118269727-118269749 CGCCCACCGGGAACTCTAGCTGG - Intergenic
960560067 3:119073716-119073738 CACCCACCCGGAACTCGCGCTGG + Intronic
960669178 3:120140295-120140317 TGCCCACCCGGAACTCTCGCTGG - Intergenic
960685479 3:120289764-120289786 CGCCCACCTGGAACTTGCGCTGG - Intergenic
960761699 3:121078869-121078891 TGCCCACCCAGAACTCCAGCTGG + Intronic
961268753 3:125671723-125671745 CGCCCACTCAGAACTCGCGCTGG - Intergenic
961280029 3:125758893-125758915 CGCCCACCCGGAACTCCAGCCGG + Intergenic
961298207 3:125903978-125904000 TGCCCACCCGGCACTCGCGCTGG - Intergenic
961460435 3:127046722-127046744 TGCCCACCCGGAACTCCAGCTGG - Intergenic
961465066 3:127076556-127076578 CGCCCACCCAGAACTCAGGCTGG + Intergenic
961688769 3:128653440-128653462 GGCCCACCCAGAACTCCAGCTGG - Intronic
961700823 3:128743237-128743259 CACCCACCCGGAACTCCCGCTGG + Intronic
961746743 3:129068584-129068606 CGCCCACCCGGAACTTGCGCTGG + Intergenic
961874376 3:130010686-130010708 CGCCCACTCGGAACTCCAGCCGG - Intergenic
961957065 3:130815147-130815169 TGCCCACCTGGAACTCACGCTGG + Intergenic
962177272 3:133167707-133167729 CACCCACCCGGAACTTGCGCTGG + Intronic
962283777 3:134070574-134070596 CGCCCACCCGGAACTCCAGCTGG + Intronic
962383792 3:134916675-134916697 CGCCCACCCGGAACTGGCGCTGG + Intronic
962398778 3:135039744-135039766 TGCCCACCCGGAACTCAAGCTGG + Intronic
962591101 3:136890315-136890337 CGCCCACCCGGAACTCCAGCTGG + Intronic
962600533 3:136987902-136987924 CGCCCACCCGGAACTCCAGCTGG + Intronic
962671716 3:137714814-137714836 CGTCCACCCGGAACTCTAGCTGG + Intergenic
962758224 3:138484694-138484716 CACCCACCCAGAACTCCAGCTGG - Intergenic
962998111 3:140651469-140651491 CACCCACCCGGAACTCACGCTGG - Intergenic
963397182 3:144749857-144749879 CGCCCACCCGGAACTCCAGCTGG - Intergenic
963397857 3:144756931-144756953 CGCCCGCTCAGAACTCACGCTGG - Intergenic
963440382 3:145333439-145333461 CGCCCACCCAGAACTCCAGCTGG - Intergenic
963509178 3:146225747-146225769 CGCCCACCCGGAACTCCAGCTGG + Intronic
963651853 3:147989695-147989717 CACCCACCCGGAACTCGAGCTGG + Intergenic
963743029 3:149098165-149098187 CGCCCACCCGGAACTCCCGCCGG + Intergenic
963744135 3:149109433-149109455 CGCCCACCCAGAACTCGCACTGG - Intergenic
963862139 3:150323013-150323035 CCCCCACCCGGAACTCCAGCTGG - Intergenic
964014344 3:151928200-151928222 CGCCCACCCGGAACTCCAGATGG - Intergenic
964032295 3:152152461-152152483 CGCCCACCCGGAACTCCAGCTGG - Intergenic
964117998 3:153156035-153156057 CGCCCACCCGGAACTCCAGCTGG + Intergenic
964139246 3:153378651-153378673 CGCCCACCCGGAACGCCAGCTGG + Intergenic
964198138 3:154088082-154088104 CGCCCACCCAGAACTCGCGCTGG - Intergenic
964265406 3:154889555-154889577 CGCCCTCCCGGAACTCGCGCTGG + Intergenic
964375030 3:156041364-156041386 CGCCCACCCGGAACTCGCGCTGG - Intronic
964376238 3:156051823-156051845 CGCCCACCCGGAACTCGTGCTGG - Intronic
964381076 3:156099513-156099535 CGCCCACCCGGAACCCACGCTGG - Intronic
964393808 3:156224240-156224262 CGCCCACCCGGAACTCGTGCTGG + Intronic
964443976 3:156740623-156740645 CGCCCACCCGGAACTCCAGCTGG - Intergenic
964452168 3:156822992-156823014 CGCCCACCCGGAACTCCAGCTGG + Intergenic
964751833 3:160060569-160060591 CGCCCACCTGGAACTCTAGCTGG - Intergenic
964802910 3:160574259-160574281 CGCCCACCCGGAACTCGCGCTGG + Intergenic
964974142 3:162599743-162599765 CACCCACCCGGAACTCGTGCTGG - Intergenic
964983179 3:162710825-162710847 CGCCCACCCGGAACTCACGCTGG + Intergenic
965040267 3:163499069-163499091 CGCCCACCCGGAACTCCAGCTGG - Intergenic
965044164 3:163552636-163552658 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965077968 3:164003016-164003038 CGCCCACCTGGAACTCCAGCTGG - Intergenic
965200372 3:165649632-165649654 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965220917 3:165924620-165924642 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965245269 3:166258783-166258805 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965256762 3:166424020-166424042 TGCCCACCCAGAACTCACGCTGG - Intergenic
965288011 3:166842857-166842879 CGCCCACCGGGAACTCCAACTGG - Intergenic
965298102 3:166975879-166975901 CGCCCACCCGGAACTCCAGCTGG - Intergenic
965446450 3:168780185-168780207 CACCCACCCGGAACTCACGCTGG - Intergenic
965652331 3:170947268-170947290 CGCCCACCTGGAACTCATGCTGG - Intergenic
965728554 3:171745934-171745956 CGCCCACCCAGAACTCGCGCTGG - Intronic
965753260 3:171999186-171999208 CGCCCACCCGGAACTCCAGCTGG + Intergenic
965943513 3:174212287-174212309 CGCCTACCCGGAACTCCAGCTGG + Intronic
966076042 3:175937420-175937442 CGCACACCCGGAACTCCAGTTGG - Intergenic
966096823 3:176213743-176213765 CGCCCACCCGGAACTCCAGCTGG + Intergenic
966108238 3:176362538-176362560 CACCCACCCGGAACTTGCGCTGG + Intergenic
966183061 3:177204209-177204231 CGCCCACTTGGAACTCACGCTGG + Intergenic
966186181 3:177228895-177228917 CGCCCACCCGGAACTCACGCTGG + Intergenic
966191046 3:177272042-177272064 CGCCCACCCGGAACTCCAGCTGG + Intergenic
966548983 3:181183302-181183324 CGCCCACCCGGAACTCACGCTGG + Intergenic
966724975 3:183100942-183100964 CGCCCACCCGGAACTCCAGCTGG - Intronic
966725463 3:183104061-183104083 CGCCCACCCGGAACTCCAGCTGG + Intronic
967234127 3:187367884-187367906 CGCCCACCCAGAACTCTAGCTGG + Intergenic
967448477 3:189596169-189596191 CGCCCACCCGGAACTCCAGCTGG - Intergenic
967499181 3:190177364-190177386 CGCCCACCCGGAACTCCAGCTGG + Intergenic
967718319 3:192789077-192789099 CACCCACCCGGAACTCGCGCTGG - Intergenic
968181626 3:196599352-196599374 CGCCTACCCGGAATTCCAGCTGG + Intergenic
968469660 4:773607-773629 CGCCCACCCGGAACTCTTGCTGG - Intergenic
968716138 4:2161315-2161337 CGCCCACCCTGAACTCCAGCTGG - Intronic
968998993 4:3965008-3965030 TGCCCACCCGGAACTCACGCTGG + Intergenic
969017687 4:4115446-4115468 TGCCCACCCAGAACTCCAGCAGG - Intergenic
969303183 4:6309340-6309362 CGCCCACCCGGAACTCTCGCTGG + Intergenic
969362328 4:6672769-6672791 CGCCCACCCTGAACTCCAGCTGG - Intergenic
969440714 4:7215174-7215196 CGCCCACCCGGAACTCCAGCTGG - Intronic
969655001 4:8491724-8491746 CGCCCACCCGGAACTCCAGCTGG + Intronic
969736302 4:8993165-8993187 CGCCCACCCGGAACTCCAGCCGG + Intergenic
969755006 4:9143623-9143645 TGCCCACCCGGAACTAGCGCTGG - Intergenic
969795500 4:9524728-9524750 CGCCCACCCAGAACTCCAGCCGG + Intergenic
970108296 4:12609679-12609701 CGCCCACCCGGAACTCTCGCTGG - Intergenic
970272100 4:14358709-14358731 TGCCCACCCGGAACTCGCGCTGG - Intergenic
970391189 4:15614959-15614981 CGCCCACCCGGAACTCCAGCTGG - Intronic
970408670 4:15787048-15787070 CGCCCACCTGGAACTCGCGCTGG + Intronic
970574604 4:17414602-17414624 AGCCCACCTGGAACTCGCGCTGG + Intergenic
970615784 4:17767121-17767143 CGCCCACCCGGAACTCGCGCTGG + Intronic
970649356 4:18159584-18159606 CGCCCACCCGGAACTCCAGCTGG + Intergenic
970673195 4:18418653-18418675 CGCCCACCCGGAACTCCAGCTGG + Intergenic
970692021 4:18630886-18630908 TGCCCACCCAGAACTCACGCTGG + Intergenic
970803497 4:20004057-20004079 CGCCCACCTGGAACTCCAGCTGG - Intergenic
970817911 4:20179339-20179361 CGCCCACCTGGAACTCGCACTGG + Intergenic
971030751 4:22634801-22634823 CGCCCACCCGGAATTTGCGCTGG - Intergenic
971043375 4:22778910-22778932 CATCCACCCGGAACTCGCGCTGG + Intergenic
971280558 4:25239547-25239569 TGCCCACCCGGAACTCGCGCTGG + Intronic
971377144 4:26064294-26064316 CGCCCACCCGGAACTCCAGCTGG + Intergenic
971553064 4:27978650-27978672 TGCCCACCCGGAACTCCAGCTGG + Intergenic
971564218 4:28117456-28117478 CGCCCACCCGGAACTCGCGCTGG + Intergenic
971639798 4:29117398-29117420 CGCCCACCCGGAACTCCAGCTGG - Intergenic
971905222 4:32716540-32716562 CGCCCACCCGGAACTCCAGCTGG + Intergenic
972022811 4:34335956-34335978 CGCCCAGCCGGAACTCCAGCTGG + Intergenic
972034815 4:34506893-34506915 CGCCCACCCAGAACTCACGCTGG + Intergenic
972173349 4:36374976-36374998 TGCCCACCTGGAACTCGCGCTGG - Intergenic
972392528 4:38626950-38626972 CACCCACCCAGAACTCCAGCTGG - Intergenic
972778587 4:42265985-42266007 CACCCACCCGGAACTCGCACTGG - Intergenic
972890445 4:43551259-43551281 CGCCCACCTGGAACTCACGCTGG - Intergenic
972900101 4:43672403-43672425 CGCCCACCCGGAACTCCAGCTGG - Intergenic
973037074 4:45420208-45420230 CGCCAACCCGGAACTCCAGCTGG - Intergenic
973041827 4:45477665-45477687 CGCCCACCCGGAACCCACGCTGG + Intergenic
973142068 4:46781724-46781746 CGCCCACCCGGAACTCATGCTGG - Intronic
973144280 4:46805107-46805129 CACCCACCCAGAACTCGCGCTGG + Intronic
973146287 4:46831084-46831106 TGCCCACCCGGAACTCTAGCTGG - Intronic
973190339 4:47378369-47378391 CACCCACCCGGAACTCGTGCTGG + Intronic
973308055 4:48675386-48675408 CGCCCACCCGGAACTCCAGCTGG - Intronic
973684375 4:53354390-53354412 CGCCCACATGGAACTCACACTGG + Intronic
973764333 4:54149614-54149636 CGCCCATCCGGAACTCGCGCTGG + Intronic
973765121 4:54155438-54155460 CACCCACCCGGAACTCCAGCTGG + Intronic
973817554 4:54632582-54632604 CGCCCACCCGGAACTCCAGCTGG - Intergenic
973854091 4:54993560-54993582 CGCCCACCTGGAACTCGCGCTGG - Intergenic
973878095 4:55241547-55241569 CGCTCACCCGGAACTTGCGCTGG - Intergenic
974089908 4:57300484-57300506 TGCCCACCCGGAACTCATGCTGG + Intergenic
974128985 4:57730093-57730115 CTCCCACCTGGAACTCCAGCTGG + Intergenic
974147391 4:57965470-57965492 CGCCCATCCGGAACTCCAGCTGG - Intergenic
974187990 4:58465167-58465189 CGCCCACCTGGAACTCATGCTGG - Intergenic
974299273 4:60042533-60042555 TGCCCACCTGGAACTCACGCTGG + Intergenic
974484817 4:62492211-62492233 CGCCCACTCGGAACTCCAGCTGG + Intergenic
974590620 4:63943189-63943211 CGCCCACCCAGAACTCCAGCTGG + Intergenic
974641770 4:64640788-64640810 CGCCCACCGGGAACTCCAGCTGG + Intergenic
974781773 4:66561796-66561818 CGCCCACCCGGAACTCCAGCTGG + Intergenic
974792794 4:66712728-66712750 CACCCACCCGGAACTCCAGTTGG + Intergenic
974804357 4:66860214-66860236 CGCCCACCCAGAACTCCAGCTGG - Intergenic
974827728 4:67151925-67151947 CGCCCACCGGAAACTCCAGCTGG - Intergenic
974838252 4:67275559-67275581 TGCCCACCCGGAACTCGCACTGG + Intergenic
974892320 4:67896875-67896897 CACCCACCCGGAACTCTAGCTGG + Intergenic
974992900 4:69115558-69115580 CGCCCACCCGGAACTCCAGCTGG + Intronic
975028071 4:69576643-69576665 CGCCCACCAAGAACTCGCGCTGG + Intergenic
975055378 4:69923937-69923959 CGCCCACCCGGAACTGCAGCTGG - Intergenic
975160680 4:71120973-71120995 TGCCCACCCGGAACTCGTGCTGG - Intergenic
975298794 4:72765944-72765966 CGCCCACACGGAACTCCTGCTGG - Intergenic
975439978 4:74399378-74399400 CGCCCACCCGGAACTTGTGCTGG + Intergenic
975595213 4:76043601-76043623 CGCCCACCCAGAACTCCAGCTGG + Intronic
975596394 4:76050972-76050994 CGCCTACCCGGAACTCCAGCTGG + Intronic
975755848 4:77570710-77570732 CGCCCACCCAGAACTCCAGCTGG - Intronic
975898407 4:79121978-79122000 CACCCACCCGGAACTCGTGCTGG - Intergenic
975994917 4:80302883-80302905 CGCCCACCTGGAACTTGCGCTGG - Intronic
976406358 4:84664763-84664785 CGCCCACCTGGAACTCCAGCTGG - Intergenic
976597014 4:86904224-86904246 CGCCCACCCGGAACCCGCGCCGG + Intronic
976646892 4:87396261-87396283 CGCCCACCCGGAACTCCAGCTGG + Intergenic
976690630 4:87863981-87864003 CGCCCACCCAGAACTCGCGCTGG + Intergenic
976980323 4:91218284-91218306 CACCCACCCGGAACTCCAGCTGG + Intronic
977206491 4:94169890-94169912 CGCCCACCCAGAACTCCAGCTGG - Intergenic
977416640 4:96742564-96742586 TGCCCACCCGGAACTCGCACTGG - Intergenic
977470729 4:97438400-97438422 TGCCCACCCGGAACTCATGCTGG + Intronic
977536648 4:98261714-98261736 GGCGCACGCGGAACGCACGCCGG + Intronic
977606962 4:98993799-98993821 CGCCCACCTGGAACTCTAGCTGG + Intergenic
977641142 4:99359720-99359742 TGCCCACCCGGAACTCACACTGG - Intergenic
977717376 4:100196835-100196857 CGCCCACCCGGAACTCCAGCTGG + Intergenic
977750991 4:100609080-100609102 CGCCCACCCAGAACTCCAGCTGG + Intronic
977885136 4:102245088-102245110 TGCCCACCCGGAACTCACGCTGG - Intergenic
978080224 4:104582028-104582050 CACCCACCCGGAACTCCAGCTGG - Intergenic
978241913 4:106525658-106525680 CGCCCACCCGGAACTCCAGCTGG + Intergenic
978285504 4:107073143-107073165 CTCCCACCCCGAACTCACGCTGG - Intronic
978463638 4:108984667-108984689 CGCCCACCCGGAACTCCCGCTGG + Intronic
978466226 4:109012519-109012541 CGCCCACCTGGAACTCGCGCTGG - Intronic
978748544 4:112222487-112222509 CGCCTACCTGGAACTCGCGCTGG - Intergenic
978886524 4:113772376-113772398 AGCCCACCCGGAACTCATGCTGG - Intergenic
978998073 4:115179731-115179753 CGCCCACCCGGAACCCCAGCTGG + Intergenic
978999600 4:115200509-115200531 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979224159 4:118265594-118265616 CGCCCACCCGGAACTCGCGCTGG - Intergenic
979290845 4:118977364-118977386 CGCCCACCCGGAACTCCAGCTGG + Intronic
979308293 4:119173831-119173853 TGCCCACCCAGAACTCCAGCTGG - Intronic
979424776 4:120551052-120551074 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979445693 4:120808881-120808903 CGCCCACCTGGAACTCACGCTGG + Intronic
979608991 4:122670262-122670284 CGCCCACCTGGAACTCGCACTGG - Intergenic
979678637 4:123435684-123435706 CGCCCACCTGGAACTCGCGCTGG + Intergenic
979688559 4:123537962-123537984 CGCCCACCCGGAACTCCAGCTGG - Intergenic
979755845 4:124339099-124339121 CGCCCACCCGGAACTCGCGCTGG - Intergenic
979822536 4:125191996-125192018 CGCCCACCCGGAACTCGCGCTGG - Intergenic
979825733 4:125229906-125229928 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979829331 4:125280994-125281016 TGCCCACCTGGAACTCGCGCTGG - Intergenic
979857529 4:125652044-125652066 CGCCCACCGGGAACTCGCGCTGG + Intergenic
979865192 4:125745037-125745059 CACCCACCCAGAACTCGCGCTGG - Intergenic
979899737 4:126201605-126201627 CGCCCACCCGGAACTCCAGCTGG + Intergenic
979920435 4:126490056-126490078 CACCCACCCAGAACTCGCGCTGG - Intergenic
979991438 4:127379980-127380002 CGCCCACCCGGAACTCCAGCTGG - Intergenic
980043410 4:127964552-127964574 CGCCCACTCGGAACTCCAGCTGG + Intronic
980051961 4:128047873-128047895 CGCCCACCCGGAACTCCAGTTGG + Intergenic
980115194 4:128672708-128672730 TGCCCACCCGGAACTCACGCTGG - Intergenic
980227951 4:130012826-130012848 TGCCCACCCGGAACTCCAGCTGG - Intergenic
980230278 4:130038857-130038879 CGCCCACCCGGAACTCCAGCTGG + Intergenic
980328437 4:131379413-131379435 CGCCCACCAGGAACCCGCGCCGG - Intergenic
980470254 4:133240723-133240745 CACCCACCCGGAACTCCAGCTGG + Intergenic
980595458 4:134948465-134948487 CGCCCACCTGGAACTCACCCTGG + Intergenic
980628569 4:135406664-135406686 CGCCCACCCGGAACTCCAGCTGG - Intergenic
980698726 4:136395393-136395415 CGCCCACCCGGAACTCTAGCTGG - Intergenic
980774465 4:137421066-137421088 CGCCCACCCAGAACTCTAGCTGG - Intergenic
980799738 4:137733782-137733804 CGCCCACCCAGAACTCCAGCTGG - Intergenic
980809220 4:137853652-137853674 CGCCCATCCGGAACCCGCGCCGG - Intergenic
980815526 4:137942116-137942138 CGCCCACCTGGAACTCCAGTTGG - Intergenic
981128390 4:141132545-141132567 CGCCCAAGCAGGACGCCCGCGGG - Exonic
981146801 4:141333508-141333530 CGCCCACCCGGAACTCCAGCTGG + Intergenic
981176612 4:141690173-141690195 TGCCCACACGGAACTCCAGCTGG + Intronic
981275795 4:142897545-142897567 CGCCCACCCGGAACTCCAGCTGG - Intergenic
982408199 4:155044349-155044371 CGCCCACCAGGAACTCCAGCTGG - Intergenic
982679071 4:158408113-158408135 CGCCCACCCGGAACTCCAGCTGG - Intronic
982692754 4:158566989-158567011 TGCCCACCCGGAACTGGCGCTGG - Intronic
982814610 4:159869349-159869371 CGCCCACCCAGAACTCCAGCTGG + Intergenic
982863359 4:160481815-160481837 CACCCACCCGAAACTCGCGCTGG - Intergenic
982868837 4:160550432-160550454 CGCCCACCCGGAATTCCAGCTGG + Intergenic
982921239 4:161277288-161277310 CGCCCACCCGGAACTCCAGCTGG - Intergenic
982985734 4:162203634-162203656 CGCCCACCCGGAACTCTAGCTGG - Intergenic
983026070 4:162739586-162739608 CGCCCGCCCGGAACTCCAGCTGG - Intergenic
983060312 4:163152891-163152913 TGCCCACCCGGAACTCCAGCTGG - Intronic
983064110 4:163190020-163190042 CGCCCACCCAGAACTCCAGCTGG + Intergenic
983230684 4:165126252-165126274 CGCCCACCCCGAACTCCAGCTGG + Intronic
983553082 4:169036150-169036172 CGCCCACCCGGAACTCCAGCTGG + Intergenic
983656712 4:170091275-170091297 CGCCCACCCGGAACTCTAGCTGG - Intronic
983734687 4:171043215-171043237 CGCCCACTCGGAACTCTAGCTGG - Intergenic
983752817 4:171298320-171298342 CGCCCACCCGGAACTCCAGCTGG - Intergenic
983843208 4:172482187-172482209 CACCCACCCGGAACTCGCGCTGG + Intronic
984095456 4:175427946-175427968 CGCCCACCCGGAACCCGCACCGG - Intergenic
984192865 4:176625478-176625500 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984238846 4:177193509-177193531 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984265627 4:177495638-177495660 TGCCCACCCGGAACTCCAGCTGG - Intergenic
984662223 4:182386606-182386628 CGCCCACCCGGAACTACAGCTGG - Intronic
984770544 4:183433220-183433242 CGCCCACCCGGAACTCCAGGTGG - Intergenic
984776132 4:183482978-183483000 CGCCCACCCGGAACTCCAGCTGG + Intergenic
984805371 4:183746754-183746776 CGCCCACCTGGAACTCGCACTGG + Intergenic
984901724 4:184591954-184591976 CGCCCACCTGGAACTCCAGCTGG - Intergenic
984918077 4:184741251-184741273 CGCCCACCCGGAACACACACTGG - Intergenic
984948750 4:184990403-184990425 CGCCCACCCGGAACTCCAGCTGG + Intergenic
985087071 4:186324630-186324652 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985145407 4:186890160-186890182 CGCCCACCCGGAACTCGTGCTGG - Intergenic
985195201 4:187421263-187421285 CGCCCACCCAGAACTCCAGCTGG + Intergenic
985203224 4:187505676-187505698 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985366373 4:189236353-189236375 CGCCCACCCGGAACTCCAGCTGG - Intergenic
985403897 4:189616960-189616982 CGCCCACCCGGAACTCCAGCTGG + Intergenic
985412124 4:189695969-189695991 CGCCCACCGGGAACTCGTGCTGG + Intergenic
986121107 5:4837585-4837607 CACCCACCCAGAACTCACGCTGG - Intergenic
986151975 5:5137831-5137853 CGCCCACCCGGAACTCCAGCTGG - Intergenic
986661714 5:10065526-10065548 CGCCCACCCGGAACTTGCACTGG - Intergenic
986697970 5:10375204-10375226 TGCCCACCCGGAACTCCAGCTGG - Intronic
986912415 5:12574259-12574281 CGCCCACCCGGAACTCCAGCTGG + Intergenic
986912558 5:12574789-12574811 CGCCCACCCGGAACTCACGCTGG + Intergenic
986963568 5:13244235-13244257 AGCCCACTCGGAACTCATGCTGG - Intergenic
986993254 5:13578557-13578579 CGCCCACCCGGAACTCGCGCTGG - Intergenic
987084496 5:14456184-14456206 CGCCCACCTGGAACTCTTGCAGG + Intronic
987146278 5:14994120-14994142 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987156816 5:15096870-15096892 TGCCCACCCGGAACTCCAGCTGG + Intergenic
987283704 5:16436228-16436250 CACCCACCCGGAACTCGTGCTGG - Intergenic
987315269 5:16717997-16718019 CGCCCACCCGCAACTCCAGCTGG - Intronic
987347455 5:16991253-16991275 CGCCTACCTGGAACTCGCGCTGG + Intergenic
987352306 5:17032707-17032729 CGCCCACCGGGAACTCGCGCTGG + Intergenic
987358200 5:17083505-17083527 CGTCCACTCCGAACTCCAGCTGG - Intronic
987365017 5:17140974-17140996 CGCCCACCCGGAACTCCCGCTGG - Intronic
987384040 5:17312087-17312109 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987532812 5:19143085-19143107 CGCCCACCCGGAACTCCAGCTGG + Intergenic
987543801 5:19287790-19287812 CGCCCACCCGGAACTCCAGCTGG - Intergenic
987696576 5:21341442-21341464 CGCCCACCCGGAAGTCGCGCTGG - Intergenic
987876924 5:23691170-23691192 CGTCCACCCAGAACTCCAGCTGG - Intergenic
987896267 5:23951342-23951364 CGCCCACCCGGAACTCCAGCTGG - Intronic
987990270 5:25200337-25200359 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988073462 5:26324467-26324489 CGCCCACCCGGAACTCCAGCTGG - Intergenic
988087016 5:26485594-26485616 CGTCCACCCGGAACTCCAACTGG + Intergenic
988132131 5:27119943-27119965 CGCCCACCCGGAACTCCAGCTGG - Intronic
988143083 5:27267512-27267534 CGCCCACCCGGAACTCATGCTGG + Intergenic
988155082 5:27439765-27439787 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988177237 5:27743507-27743529 CGCCCACCCGGAACTCCAGCTGG - Intergenic
988279580 5:29127937-29127959 CACCCACCCGGAACTCCAGCTGG + Intergenic
988369215 5:30345774-30345796 CACCCACCCGGAACTCGTGCTGG - Intergenic
988489157 5:31692279-31692301 CGCCCACTCGGAACTTGCGCTGG + Intronic
988684762 5:33515701-33515723 CGCCCACCCGGAACTCCAGCTGG + Intergenic
988755627 5:34245128-34245150 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
988883561 5:35531672-35531694 CGCCCACCTGGAACTCCAGCCGG - Intergenic
988915922 5:35893182-35893204 CGCCCACCCGGAACTCCAGCTGG + Intergenic
989003175 5:36782627-36782649 CGCCCACGGGGAACTCCAGCTGG - Intergenic
989346772 5:40438705-40438727 CGCCCACCCGGAACTCCAGCTGG - Intergenic
989559654 5:42836414-42836436 CGCCCACCAGGAACTCGTGCTGG - Intronic
989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG + Intergenic
989777360 5:45225679-45225701 CGAGCACCCGGAACTCACGCTGG - Intergenic
989956821 5:50369484-50369506 CACCCACCCAGAACTCCAGCTGG - Intergenic
989957904 5:50376878-50376900 CACCCACCCAGAACTCCAGCTGG - Intergenic
989965803 5:50465060-50465082 CGCCCACCCGGAACTCCAGCTGG - Intergenic
990243234 5:53837017-53837039 TGCCCACCCAGAACTCACGCTGG - Intergenic
990345235 5:54865123-54865145 CGCCCACCCGGAACTCCAGCTGG - Intergenic
990418942 5:55613397-55613419 CGCCCACCCAGAACTCGCGCTGG - Intergenic
990461498 5:56035535-56035557 TGCCCACCCGGAACTCCAGCTGG - Intergenic
990490051 5:56295398-56295420 CGCCCAACCGGAACTCCAGCTGG - Intergenic
991214921 5:64150126-64150148 CGCCCACCCGGAACTCTAGCTGG - Intergenic
991330251 5:65485746-65485768 CGCCCACCCGGAACTCGCACTGG + Intergenic
991505398 5:67318908-67318930 TGCCCACCCGGAACTTGCGCTGG - Intergenic
991567596 5:68020718-68020740 CGCCCACCCGGAACTCCAGCTGG + Intergenic
991743878 5:69710899-69710921 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
991753834 5:69844343-69844365 CGCCCACCCGGAAGTCGCGCTGG - Intergenic
991795450 5:70290631-70290653 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
991803451 5:70401070-70401092 CGCCCACCCGGAAGTCGCGCTGG - Intergenic
991823246 5:70586167-70586189 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
991833147 5:70719456-70719478 CGCCCACCCGGAAGTCGCGCTGG - Intergenic
991887817 5:71290150-71290172 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
992050338 5:72935284-72935306 CGCCCACCCGGAACTCACGCTGG - Intergenic
992296714 5:75333731-75333753 CGCCCACCCGGAACTCCAGCTGG - Intergenic
992947291 5:81823107-81823129 CGCCCACCCGGAACTCCAGCTGG + Intergenic
992947423 5:81823768-81823790 CGCCCACCCGGAACTCCAGCTGG - Intergenic
993031840 5:82714726-82714748 CGCCCACCCGGAACTCCAGCTGG - Intergenic
993202232 5:84830611-84830633 CGCCCACCTGGAACTCCCGCTGG + Intergenic
993320959 5:86466995-86467017 TGCCCACCTGGAACTCCAGCTGG + Intergenic
993328605 5:86569838-86569860 AGCCCACCCTGAACTCCAGCTGG + Intergenic
993678621 5:90847787-90847809 CGCCCACCCGGAACTCGCGCTGG + Intronic
993770257 5:91917323-91917345 CGCCCACCCGGAACTCGCGCTGG - Intergenic
993822008 5:92631379-92631401 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994096314 5:95851213-95851235 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994210800 5:97085543-97085565 TGCCCACCCGGAACTCGCGCTGG + Intergenic
994251545 5:97542193-97542215 CATCCACCCGGAACTCCTGCTGG + Intergenic
994254816 5:97580307-97580329 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994507084 5:100656809-100656831 CGCCCACCCGGAACTCCAGCTGG - Intergenic
994509867 5:100689181-100689203 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994570274 5:101506073-101506095 CACCCACCCGGAACTCACACTGG - Intergenic
994605629 5:101962760-101962782 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994620313 5:102154986-102155008 CGCCCACCCGGAACTCTAGCTGG - Intergenic
994647775 5:102491661-102491683 CGCCCACCCAGAACTCGTGCTGG + Intronic
994669726 5:102752113-102752135 CGCCCACCCGGAACTCTAGCTGG - Intergenic
994701726 5:103142351-103142373 CGCCCACCCAGAACTCCAGCTGG + Intronic
994769813 5:103966639-103966661 CGCCCACCCGGAACTCCAGCTGG + Intergenic
994928791 5:106154352-106154374 CGCCTACGCGGAACTCCAGCTGG - Intergenic
994935264 5:106246299-106246321 CGCCCACCCGGAACTCCAGCTGG - Intergenic
995032294 5:107494291-107494313 CGCCCACCCGGAACTCCAGCTGG - Intronic
995112395 5:108442353-108442375 CGCCCACCCAGAACTCATGCTGG + Intergenic
995206677 5:109488125-109488147 CGCCCACCCGGAACTCGCGCTGG + Intergenic
995568650 5:113457190-113457212 GGCCCACCTGGAACTCCAGCTGG - Intronic
995596476 5:113753432-113753454 CGCCCACCCGGAACTCCAGCTGG + Intergenic
995656483 5:114432727-114432749 CGCCCACCCGGAACTCCAGCTGG - Intronic
995679897 5:114704603-114704625 TGCCCACCCGGAACTCCAGCTGG + Intergenic
995700337 5:114928882-114928904 CGTCCACCTGGAACTCACGCTGG - Intergenic
995920371 5:117304707-117304729 CGCCCACCCGGAACTCCAGCTGG - Intergenic
995975784 5:118033825-118033847 CGCCCACCCGGAACTCTAGCTGG - Intergenic
996107021 5:119517150-119517172 CGCCCACCCAGAACTCAAGCTGG - Intronic
996234197 5:121107223-121107245 CGCCCACCCGGAACTCCAGCTGG - Intergenic
996298583 5:121954266-121954288 CGCCCACCCGGAACTAGCGCTGG + Intergenic
996435664 5:123430593-123430615 CGCCCACCCGGAACTCGCGCTGG - Intergenic
996478719 5:123949502-123949524 TGCCCACCCGGAACTCCCGCTGG + Intergenic
996567171 5:124892462-124892484 CGCCCACCCGGAACTCGCGCTGG - Intergenic
996585975 5:125088749-125088771 CGCCCACCCGGAACTCGCGCTGG - Intergenic
996681164 5:126229149-126229171 CGCCCACCCGGAACCCACGCTGG - Intergenic
996747124 5:126854845-126854867 CGCCCACCCGGAACTCACGCTGG + Intergenic
996815550 5:127569501-127569523 CGCCCACCCGGAACTCGCGCTGG - Intergenic
997158223 5:131580348-131580370 CGCCCACCCGGAACTTGTGCTGG + Intronic
997352193 5:133239033-133239055 TGCCCACCCGAAACTCACGCTGG - Intronic
997760532 5:136444259-136444281 CACCCACCCGGAACTCCAACTGG - Intergenic
998095195 5:139392570-139392592 CGTCCAGGCGCCACTCCCGCGGG - Exonic
998117511 5:139549391-139549413 CGCGCACCCGGAACTCGCGCTGG - Intronic
999348526 5:150845510-150845532 CGCCCACCCGGAACTCGTGCTGG - Intergenic
999406153 5:151309233-151309255 CGCCCACCCGGAACTCCAGCTGG - Intergenic
999855310 5:155587065-155587087 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1000066007 5:157693884-157693906 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1000084721 5:157879336-157879358 TGCCCACCCGGAACTTGCGCTGG - Intergenic
1000212339 5:159119219-159119241 CGCCCACCCGGAACTCACGCTGG - Intergenic
1000329218 5:160194211-160194233 CGCCCACCGGCAACTCCAGCTGG + Intronic
1000891844 5:166810510-166810532 CACCCACCCAGAACTCCAGCTGG + Intergenic
1000902511 5:166927261-166927283 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1001636421 5:173213491-173213513 CGCCCACCCAGAACTCTAGCTGG - Intergenic
1002004662 5:176222339-176222361 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1002221716 5:177688281-177688303 CGCCTACCCGGAACTCCAGCTGG - Intergenic
1002616420 5:180459218-180459240 CGCCCACCCAGAACTTCTGCTGG - Intergenic
1002688298 5:181032523-181032545 CTCCCACCCGGAACCCCCGCCGG - Intergenic
1002789404 6:426515-426537 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1002790755 6:435852-435874 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1002793183 6:450032-450054 CGCCCACCCGGAACTGTAGCTGG - Intergenic
1002817685 6:694673-694695 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1002887828 6:1312045-1312067 CGCCCCCGCGGAGCCGCCGCAGG + Intergenic
1002907050 6:1457285-1457307 CGCCCACCCTGAACTCGCGCTGG + Intergenic
1003048944 6:2763582-2763604 CTCCCACCCGGAACTCGCGCTGG + Intergenic
1003060698 6:2860190-2860212 CGTCCACCCGGAACTCCAGCTGG - Intergenic
1003061926 6:2870381-2870403 CGCCCACCTGGAACTCATGCTGG + Intergenic
1003069643 6:2935855-2935877 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1003070196 6:2939676-2939698 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003100164 6:3170812-3170834 CGCCCACCTGGAACTCTAGCTGG - Intergenic
1003170876 6:3721079-3721101 GGCCCACCCGGAACTCCAGCTGG + Intergenic
1003176849 6:3758210-3758232 CGCCCGCCCGGAACTCGCGCTGG - Intergenic
1003177258 6:3761435-3761457 CGCCCACCCGGAACTCGCGCCGG - Intergenic
1003178461 6:3771684-3771706 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1003213725 6:4090188-4090210 CGCCCACCCGGAACTGGCGCTGG - Intronic
1003224489 6:4191603-4191625 CGCCCACCTGGAACTCTAGCTGG + Intergenic
1003284876 6:4725621-4725643 CGCCCACCCGGAACTCGCACTGG + Intronic
1003489245 6:6606740-6606762 CGCCCACCCGGAACTCGCGCTGG + Intronic
1003490052 6:6613562-6613584 CGCCCACCGGGAACTCGCTCTGG + Intronic
1003506699 6:6745988-6746010 CGCCCACCCGGAACTTGCGCTGG + Intergenic
1003508863 6:6762794-6762816 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1003578015 6:7315267-7315289 CGCCCACCCGGAACTCGCACTGG - Intronic
1003578316 6:7317048-7317070 CGCCCACCCGGAACTCGCGCTGG + Intronic
1003581419 6:7344263-7344285 CGCCTACCCGGAACTCCAGCTGG - Intronic
1003589582 6:7425828-7425850 CACCCACGCGGAACTCGCGCTGG - Intergenic
1003593693 6:7456406-7456428 CGCCCACCCAGAACTCGCGCTGG - Intergenic
1003671513 6:8164383-8164405 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003717672 6:8666014-8666036 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1003736872 6:8887213-8887235 TGCCCACCCCGAACTCCAGCTGG - Intergenic
1003747984 6:9024324-9024346 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1003770184 6:9290750-9290772 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1003836237 6:10074992-10075014 CGCCCACCCGGAACTCGCGCTGG + Intronic
1003845705 6:10171769-10171791 TGCCCACCCGGAACTCCAGCTGG - Intronic
1003862766 6:10337457-10337479 CGTCCACCCGGAACTCCAGCTGG - Intergenic
1003897038 6:10617331-10617353 CGCCCACCCGGAACTCACGCTGG + Intronic
1003901566 6:10659932-10659954 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1003908102 6:10720640-10720662 CGCCCACCCGGAACTCCAACTGG - Intergenic
1003947254 6:11087263-11087285 CGCCCACCCGGAGCTCCAGCTGG - Intergenic
1003956653 6:11171120-11171142 CACCCACCCGGAACTCACGCTGG - Intergenic
1003982495 6:11402896-11402918 CGCCCACCGGGAACTCTAGCTGG + Intergenic
1003983996 6:11417308-11417330 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1004036940 6:11933127-11933149 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1004053179 6:12108704-12108726 CGCCCACCCGGAGCTCCAGCTGG + Intronic
1004220587 6:13743247-13743269 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1004224373 6:13772536-13772558 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1004233731 6:13855031-13855053 CGCCCAACCGGAACTCCAGCTGG + Intergenic
1004235568 6:13872236-13872258 CGCCCACGCGGAACTCTAGCTGG + Intergenic
1004250291 6:14018081-14018103 CCCCCACCCGGAACTCGTGCTGG - Intergenic
1004338238 6:14783881-14783903 CGCCCACCCGGAACTCGCGCCGG + Intergenic
1004452413 6:15759072-15759094 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1004483245 6:16040632-16040654 CGCCCACCCAGAGCTCGCGCTGG + Intergenic
1004486296 6:16069501-16069523 CGCCCACCCGGAACTCCAGCGGG + Intergenic
1004499698 6:16198404-16198426 CGCCCACCCGGAAATCTAGCTGG + Intergenic
1004502114 6:16218311-16218333 CGCCCACCCGGAACTGCAGCTGG + Intergenic
1004511622 6:16288300-16288322 CACCCACCCGGAACTCCAGCTGG - Intronic
1004587462 6:17016074-17016096 CGCCCACCCGGAACTTGCGCTGG + Intergenic
1004607395 6:17206752-17206774 TGCCCACCCGGAACTCGCGCTGG + Intergenic
1004663288 6:17728806-17728828 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1004665552 6:17745621-17745643 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1004689118 6:17976502-17976524 CGCCCACCCAGAACTCCAGCTGG + Intronic
1004811804 6:19270822-19270844 CGCCCACCTGGAACCCCCACCGG - Intergenic
1004861402 6:19807282-19807304 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1004866082 6:19854740-19854762 CGCCCACGCGGAACTCCAGCTGG + Intergenic
1004905411 6:20233264-20233286 CGCCCACCTGGAACTCGCGTTGG - Intergenic
1004906188 6:20239109-20239131 CGCCCACCTGGAACTCGCGCTGG - Intergenic
1004906960 6:20245084-20245106 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1004908495 6:20259614-20259636 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1004912604 6:20301299-20301321 GGCCCAACCGGAACTCCTGCTGG - Intergenic
1004914425 6:20318965-20318987 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1005035594 6:21552598-21552620 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005059257 6:21761205-21761227 CACCCACCTGGAACTCGCGCTGG - Intergenic
1005117754 6:22356723-22356745 CACCCACCTGGAACTCGCGCCGG + Intergenic
1005332906 6:24766250-24766272 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005554265 6:26956903-26956925 CGCCCACCCGGAAGTCGCGCTGG + Intergenic
1005561419 6:27045332-27045354 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1005596236 6:27381372-27381394 CGCCCAACCGGAACTCCAGCTGG + Intronic
1005600901 6:27425142-27425164 CGCCCTCCCGGAACTCCAGCTGG + Intergenic
1005711996 6:28511885-28511907 CTCCCACGTGGAATTCGCGCTGG - Intronic
1005725083 6:28640056-28640078 CGCCCACCCGGAACTCACCCTGG + Intergenic
1005749088 6:28866754-28866776 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1005749957 6:28872907-28872929 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005758919 6:28950107-28950129 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1005759781 6:28957891-28957913 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1005766288 6:29015141-29015163 CGCCCACCCGGAACTCGCACTGG - Intergenic
1005977031 6:30807756-30807778 CGCCCACCCGGAACTCCCGCTGG + Intergenic
1005978266 6:30816612-30816634 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1006005754 6:31000536-31000558 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006033611 6:31195507-31195529 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006127942 6:31852103-31852125 CGCCCACCCGGAACTTGCGCTGG - Intergenic
1006151475 6:31992382-31992404 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006157776 6:32025120-32025142 CGTCCACGCTGAGCTCCAGCTGG - Exonic
1006348449 6:33502746-33502768 CACCCACCTGGAACTCGCGCTGG - Intergenic
1006351126 6:33521813-33521835 CGCCCACCCGGAACTCGAGCTGG + Intergenic
1006352615 6:33532436-33532458 CGCCCACCTGGAACTTCAGCTGG - Intergenic
1006477805 6:34269072-34269094 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1006497919 6:34437320-34437342 CGCCCACCCAGAATTCGCGCTGG + Intergenic
1006695985 6:35931313-35931335 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1006706377 6:36024619-36024641 AGCCCGCCCGGAACGCCCGCGGG - Exonic
1007738711 6:43998144-43998166 CGCCCACCCGGAACTTGCGCTGG - Intergenic
1008005618 6:46406080-46406102 CGCCCACCCAGAACTCCAGCTGG + Intronic
1008038756 6:46774645-46774667 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1008284371 6:49629863-49629885 TGCCCACCCAGAACTCCAGCTGG + Intronic
1008631157 6:53363766-53363788 CGCCCACTGGGAACTCGCACTGG + Intergenic
1008770971 6:54979282-54979304 CGCCCACCCGGAATTCCAGCTGG - Intergenic
1008844812 6:55950356-55950378 TGCCCACCCGGAACTCGCACTGG - Intergenic
1009402706 6:63275244-63275266 CTCCCACCCAGAACTCGCGCTGG + Intergenic
1009407123 6:63326768-63326790 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1009470256 6:64023823-64023845 CGCCCACCTGGAACTCGCGCTGG - Intronic
1009615518 6:65999680-65999702 CGTCCACCTGGAACTCACGCTGG + Intergenic
1009685312 6:66949262-66949284 CACCCACCCGGAACTCCAGCTGG - Intergenic
1009800703 6:68533480-68533502 CGCCCACCCAGAACTCAGGCTGG - Intergenic
1010066272 6:71686206-71686228 CGCCCACCCGGAACTCCCGCTGG - Intergenic
1010199340 6:73269187-73269209 TGCCCACCCGGAACTCCAGCTGG + Intronic
1010235675 6:73572850-73572872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1010269322 6:73903205-73903227 CACCCACCCAGAACTCACGCTGG - Intergenic
1010277970 6:73990944-73990966 CACCCACCCGGAACTCGCGCTGG + Intergenic
1010617354 6:78029845-78029867 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1011129353 6:84037772-84037794 CGCCCACCTAGAACTCACGCTGG + Intronic
1011143665 6:84189414-84189436 TGCCCACCCGGAACTCCAGCTGG - Intronic
1011338371 6:86285090-86285112 CACCCACCTGGAACTCACGCTGG + Intergenic
1011601587 6:89065070-89065092 CGCCCCCCTGGAACTCCAGCTGG - Intergenic
1011620113 6:89234760-89234782 CGCCCACCCAGAACTCACGCTGG + Intergenic
1011879953 6:92012057-92012079 CGCCCACCCAGAACTCGCGCTGG + Intergenic
1011931779 6:92723544-92723566 CGCCCACCCGGAACTCACGCTGG - Intergenic
1011974741 6:93282693-93282715 CGCCCACCGGGAACTCGCGCTGG - Intronic
1012189366 6:96261259-96261281 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1012733559 6:102910954-102910976 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1012760528 6:103294717-103294739 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1012850973 6:104446382-104446404 CGCCCACCCGGAACTCACGCTGG - Intergenic
1013025748 6:106269720-106269742 CACCCACCCGGAACTCCAGCTGG + Intronic
1013080208 6:106805811-106805833 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1013081512 6:106817076-106817098 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1013143594 6:107364559-107364581 CGCCCACCCGGAACTCCAGCTGG + Intronic
1013410801 6:109881455-109881477 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1013694829 6:112689637-112689659 CGCGCACCCGGAACTCGCGCTGG + Intergenic
1013955371 6:115834914-115834936 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1013957220 6:115855242-115855264 CGCCCACCTGGAACTCATGCTGG - Intergenic
1013960067 6:115889151-115889173 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1013963468 6:115928353-115928375 CGCCCACCCGGAACTCGTGGTGG + Intergenic
1014055861 6:117014807-117014829 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014240714 6:119015370-119015392 CACCCACCCAGAACTCCAGCTGG - Intronic
1014280785 6:119441046-119441068 CACCCACCCGGAACTCGCGCTGG - Intergenic
1014460278 6:121686727-121686749 CGCCCACCCGGAACTTGCGCTGG + Intergenic
1014507737 6:122280627-122280649 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014718538 6:124892019-124892041 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1014738972 6:125125899-125125921 CACCCACCCGGAACTTGCGCCGG - Intronic
1014788447 6:125644498-125644520 CGCCCACCCGGAACTCCCGCTGG - Intergenic
1014921098 6:127214904-127214926 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1015572280 6:134633859-134633881 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1015600320 6:134904777-134904799 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1016067398 6:139698229-139698251 GGCCCACCCGGAACTCCAGCTGG + Intergenic
1016069914 6:139726662-139726684 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1016092858 6:139999898-139999920 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1016104754 6:140148434-140148456 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1016217170 6:141618258-141618280 CGCCCACCCAGAACTCCCGCTGG - Intergenic
1016482343 6:144495457-144495479 AGCCCACCCGGAACTCCAGCTGG + Intronic
1016858944 6:148698358-148698380 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1016859084 6:148698894-148698916 CGCCCACCCGGAACTGGCGCTGG + Intergenic
1017298957 6:152834390-152834412 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1017310064 6:152966243-152966265 CGCCCACCCGGAACTGGCCCTGG + Intergenic
1017325060 6:153133668-153133690 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1017839536 6:158210102-158210124 CGCCCACTCAGAACTCCAGCTGG + Intergenic
1018064264 6:160114815-160114837 CGCCCACCCGGAATTCCAGCTGG + Intergenic
1018109426 6:160520581-160520603 CGCACACCCGGAACTCGCGCTGG + Intergenic
1018545650 6:164933346-164933368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1018551354 6:165001898-165001920 TGCCCACCCGGAACTCGTGCTGG + Intergenic
1018624673 6:165765600-165765622 CGCCCACCTGGAACTCCAGCTGG + Intronic
1019000290 6:168744099-168744121 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1019618377 7:1977430-1977452 CGCCCACCCAGAACTCGCACTGG + Intronic
1019944298 7:4314252-4314274 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1019965780 7:4497244-4497266 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1020008260 7:4793574-4793596 CGCCCACCCGGAACTCGCGCTGG - Intronic
1020552299 7:9621760-9621782 CGCCCACCCGGAACTCACGCTGG + Intergenic
1020662220 7:10995841-10995863 TGCCCACCCGGAACTCGCGCTGG + Intronic
1020784468 7:12556472-12556494 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1021324097 7:19245530-19245552 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1021513839 7:21461559-21461581 CACCCACCCGGAACTCTAGCTGG + Intronic
1021520721 7:21536849-21536871 CGCCCACCCGGAACTTGTGCTGG + Intergenic
1021567364 7:22028726-22028748 CGCCCACCCGGAACTCACGCTGG - Intergenic
1021567910 7:22032638-22032660 CACCCACCCGGAACTCGCGCTGG + Intergenic
1021686788 7:23194041-23194063 CGCCCACTCGGAACTCCAGCTGG + Intronic
1021761306 7:23905028-23905050 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1022174163 7:27857326-27857348 CGCCCACCCGGAACTCGTGCTGG + Intronic
1022750409 7:33219020-33219042 CACCCACCCGGAACTCCAGCTGG - Intronic
1023127916 7:36973790-36973812 CGCCCATCTGGAACTCCAGCTGG - Intronic
1023232479 7:38049801-38049823 CGCCCACCCGGAACTCACGCTGG - Intergenic
1023396232 7:39754253-39754275 CGCCCACCTGGAACTCTAGCTGG + Intergenic
1023773559 7:43582920-43582942 CCCCCTCGCTGAGCTCCCGCGGG - Intronic
1024269048 7:47628523-47628545 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1024691250 7:51805881-51805903 CGCCCACCAGGAACTCCAGCTGG - Intergenic
1024735848 7:52303227-52303249 CGCCCACCCAGAACTCGCGCTGG + Intergenic
1024794318 7:53003980-53004002 TGCCCACTGGGAACTCCAGCTGG - Intergenic
1024834018 7:53495067-53495089 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1026098367 7:67364838-67364860 CGCTCACCCGGAACTCGCGCTGG + Intergenic
1026335872 7:69393875-69393897 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1026512315 7:71037641-71037663 CGCCCACCCTGAACTCCAGCTGG - Intergenic
1026596586 7:71738393-71738415 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1027238037 7:76309751-76309773 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1027561641 7:79739346-79739368 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1027564067 7:79768278-79768300 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1027579744 7:79977923-79977945 GGCCCACCCAGAACTCCAGCTGG + Intergenic
1027665867 7:81042755-81042777 CACCCACCCGGAACTCCAGCTGG - Intergenic
1027667558 7:81057797-81057819 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1027674444 7:81141784-81141806 CACCCACCCAGAACTCGCGCTGG - Intergenic
1027778936 7:82499659-82499681 CGCCTACCCAGAACTCGCGCTGG - Intergenic
1027868069 7:83673364-83673386 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1027956028 7:84880627-84880649 CGCCCACCCGGAACTTGCGCGGG - Intergenic
1028070064 7:86440613-86440635 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1028142474 7:87288770-87288792 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1028303319 7:89229042-89229064 CGCCCACCTGGAACTCGCGCTGG + Intronic
1028392642 7:90334467-90334489 CGCCCACCCAGAACTCTAGCTGG - Intergenic
1028511248 7:91627707-91627729 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1028558058 7:92143639-92143661 CGCGCACCCGGAACTCGCGCTGG + Intronic
1028719446 7:94012181-94012203 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1028727152 7:94100938-94100960 CGCCCACCCGGAACTCACACTGG - Intergenic
1028778299 7:94705541-94705563 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1028852549 7:95552780-95552802 CACCCACCCGGAACTCCAGCTGG + Intergenic
1028912963 7:96228753-96228775 CGCCCACCCAGAACTCACGCTGG - Intronic
1029065369 7:97843179-97843201 CACCCACCTGGAACTCGCGCTGG + Intergenic
1029076128 7:97935976-97935998 CGCCCACCTGGAACTCCAGCCGG - Intergenic
1029407065 7:100381774-100381796 CGCCCACCCAGAACTCTAGCTGG - Intronic
1029567485 7:101348621-101348643 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1029809647 7:103034517-103034539 CGCCCACCCGGAACTCCCGCTGG + Intronic
1029832401 7:103275239-103275261 CGCCCACCCGGAACTCCAGATGG + Intergenic
1029988139 7:104940203-104940225 CACCCACCCGGAACTCGTGCTGG - Intergenic
1030215746 7:107042632-107042654 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1030292668 7:107888033-107888055 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1030367041 7:108657531-108657553 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1030600009 7:111582257-111582279 CGCCCACCCGAAACTCCAGCTGG + Intergenic
1030733454 7:113017389-113017411 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1030780386 7:113593366-113593388 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1030950936 7:115790045-115790067 CGCCCACCCGGAACTCTTGAAGG + Intergenic
1030980706 7:116182236-116182258 CGCCCACCCGGAACTAGCGCTGG + Intergenic
1031056558 7:116998312-116998334 CACCCACCCGGAACTCACACTGG + Intronic
1031109948 7:117596191-117596213 CACCCACCCAGAACTCGCGCTGG - Intronic
1031213369 7:118858962-118858984 CGCCCACCCGGAACTGGCGCTGG + Intergenic
1031292283 7:119951825-119951847 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1031378770 7:121060016-121060038 CGCCCACCCGGAACTCCAGCTGG - Intronic
1031409184 7:121421776-121421798 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1031605545 7:123763485-123763507 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1031902839 7:127429212-127429234 CGCCCACCCGGAACTTGAGCTGG - Intronic
1032248048 7:130230068-130230090 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1032339624 7:131058809-131058831 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1032561633 7:132898921-132898943 CACCCACCCGGAACTCCAGCTGG + Intronic
1033065059 7:138146210-138146232 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1033312453 7:140271619-140271641 CGCCCACCCAGAACTGGCGCTGG + Intergenic
1033394111 7:140957258-140957280 CACCCACCCGGAACTCCAGCTGG + Intergenic
1033664132 7:143424711-143424733 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1033758625 7:144418212-144418234 CGCCCACCTGGAACTCATGCTGG + Intergenic
1033779298 7:144650466-144650488 CACCCACCTGGAACTCGCGCTGG - Intronic
1033866664 7:145697683-145697705 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1034091015 7:148363854-148363876 CGCCCACCCGGAACTCCAGCTGG - Intronic
1034097886 7:148426455-148426477 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1034100382 7:148445539-148445561 CGACCACCCGGAACTCACGCTGG + Intergenic
1034154990 7:148949127-148949149 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1034167782 7:149039011-149039033 CGCCCAGCCGGAACTTCAGCTGG + Intergenic
1034632163 7:152539174-152539196 CACCCACCCGGAACTCCAGCTGG + Intergenic
1034656069 7:152730590-152730612 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1034900824 7:154906969-154906991 GGCCCACCCAGAACTCGCGCTGG - Intergenic
1034967134 7:155398463-155398485 CGCCCACCCGGAAGTCACGCTGG + Intergenic
1035151212 7:156874318-156874340 CGCCCACCCGGAACTCCAGCTGG + Intronic
1035325393 7:158062617-158062639 CGCCCACCCAGAACTCGTGCTGG - Intronic
1035683598 8:1507464-1507486 CGCCCACCCAGAACTCGCGCTGG + Intronic
1035833887 8:2727881-2727903 CGCCCACCGGGAACTCGCGCTGG - Intergenic
1035999217 8:4582873-4582895 CGCCCACCCGGAACTCCAGCTGG - Intronic
1036123845 8:6045332-6045354 CGCCCACCCGGAACTCGCACGGG + Intergenic
1036135037 8:6152753-6152775 CGCCCACCCGGAACTTGTGCTGG - Intergenic
1036260452 8:7235744-7235766 CGCCCATCCAGAACTCCAGCCGG - Intergenic
1036306163 8:7603778-7603800 CGCCCATCCAGAACTCCAGCCGG + Intergenic
1036312489 8:7694300-7694322 CGCCCATCCAGAACTCCAGCCGG - Intergenic
1036357008 8:8051763-8051785 CGCCCATCCAGAACTCCAGCCGG + Intergenic
1036378243 8:8218939-8218961 TGCCCACCCGGAACTCACGCTGG - Intergenic
1036441062 8:8781706-8781728 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1036554676 8:9848070-9848092 CGCCCACCCGGAACTCGCACTGG + Intergenic
1036801344 8:11794851-11794873 CGCCCACCCGGAACTTGCGCTGG - Intergenic
1036831342 8:12022708-12022730 CGCCCACCCGGAACTCCAGCCGG - Intergenic
1036914952 8:12796341-12796363 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1036928678 8:12931619-12931641 CGCCTACCCGGAACTCGCGCTGG + Intergenic
1037064986 8:14566868-14566890 CGCCCACCTGGAACTCGCACTGG - Intronic
1037241524 8:16783952-16783974 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1037263870 8:17037132-17037154 CGCCCACCTGGAACTCCAGCTGG + Intronic
1037558932 8:20054837-20054859 CGCCCACCCAGAACTCGCACTGG - Intergenic
1037810945 8:22086600-22086622 AGCCCACCCGGAACTCCAGCTGG - Intergenic
1037957583 8:23071100-23071122 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1037971369 8:23174115-23174137 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1037983502 8:23272164-23272186 CGCCCACCCGGAACTCCAGCTGG - Intronic
1038002645 8:23404266-23404288 CTCCCCCGCGGAGCTCCCTCTGG - Intronic
1038174043 8:25164542-25164564 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1038638250 8:29304299-29304321 TGCCCACCGGGAACTCCAGCTGG - Intergenic
1038639376 8:29311511-29311533 CACCCACCTGGAACTCCAGCTGG - Intergenic
1038726689 8:30088196-30088218 CGCCCACCCGGAACCTGCGCCGG - Intergenic
1038847624 8:31244420-31244442 CGCCCACCCGGAACTCACGCTGG + Intergenic
1038870672 8:31489902-31489924 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1039068710 8:33631724-33631746 CGCCCACCCAGAACTCTAGCTGG - Intergenic
1039069143 8:33634147-33634169 CGCCCACACGGAACTCCAGCTGG + Intergenic
1039284840 8:36028872-36028894 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1039587593 8:38719911-38719933 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1039637271 8:39180160-39180182 CGCCCACCCGGAACTCCAGCTGG - Intronic
1040000848 8:42575261-42575283 TGCCCACCCGGAACTCATGCTGG - Intergenic
1040003721 8:42600376-42600398 TGCCCACCTGGAACTCGCGCTGG + Intergenic
1040014425 8:42689539-42689561 CGCCCATCCGGAACTCGCGCTGG - Intergenic
1040026526 8:42786821-42786843 CGCCCACCTGGAACTCACGCTGG - Intronic
1040027538 8:42795673-42795695 CACCCACCCAGAACTCACGCTGG - Intronic
1040323938 8:46331779-46331801 CGCCCACCCAAAACTCGCGCTGG - Intergenic
1040583441 8:48716300-48716322 CGCCCACCCAGAACTCGTGCTGG + Intronic
1040723098 8:50349964-50349986 CGCCCACCCAGAACTCCAGCTGG - Intronic
1040790998 8:51230704-51230726 CGCGCACCCGGAAGTCGCGCTGG - Intergenic
1040804320 8:51377563-51377585 CGCCCACCCGGAACTCGCGCTGG - Intronic
1040806865 8:51405121-51405143 CGCCCACCCAGAACTGGCGCTGG + Intronic
1040952729 8:52953171-52953193 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1040952864 8:52953859-52953881 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1040954950 8:52970161-52970183 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1041034685 8:53776213-53776235 CGCCCACCCAGAACTCCAGCTGG + Intronic
1041068512 8:54104290-54104312 CGCCCACCCGGAACTTGCTCTGG - Intergenic
1041604370 8:59762269-59762291 CGCCCACCCGGAATTCGTGCTGG + Intergenic
1041636701 8:60153270-60153292 CGCCCACCCGGAACTCGCACTGG + Intergenic
1041914500 8:63126155-63126177 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1041918904 8:63162035-63162057 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1042336004 8:67630770-67630792 CGGCCACCCGGAACTCACACTGG - Intronic
1042512594 8:69626786-69626808 CGCCCATCCGGAACTCCAGCTGG + Intronic
1043073377 8:75665779-75665801 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1043102247 8:76060721-76060743 TGCCCACCCGGAACTCGCACTGG + Intergenic
1043110094 8:76169654-76169676 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1043346431 8:79303540-79303562 CGCCCACCGGGAACTCCAGCTGG - Intergenic
1043352517 8:79377519-79377541 AGCCCACCCGGAACTCCAGCTGG + Intergenic
1043435294 8:80231854-80231876 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1043621058 8:82192564-82192586 CGCCCACCCAGAACTTGCGCTGG + Intergenic
1043640143 8:82441468-82441490 CGCCCACCCGGAACTGGAGCTGG - Intergenic
1043701101 8:83290398-83290420 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1043709852 8:83402984-83403006 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1043731965 8:83694270-83694292 AGCCCACCCGGAACTCGTGCTGG + Intergenic
1043857135 8:85276108-85276130 CGCCCACCCGGAACTCGTGCTGG - Intronic
1044075795 8:87820880-87820902 CGCCCACCCGGAACTGCAGCTGG - Intergenic
1044088461 8:87971193-87971215 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1044302903 8:90606411-90606433 CGCCCACCTGGAACCCGCGCTGG + Intergenic
1044404868 8:91816409-91816431 CGCCCACCCAGAACTGGCGCTGG - Intergenic
1044441620 8:92230821-92230843 CACCCACCTGGAACTCGCGCCGG - Intergenic
1044459677 8:92429544-92429566 CGTCCACCCGGAACTCGTGCTGG + Intergenic
1044633504 8:94300648-94300670 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1044788654 8:95823684-95823706 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1044821980 8:96160993-96161015 CGCCCCCGCGGGACGCGCGCGGG + Intergenic
1044853555 8:96452378-96452400 CGCCCACCCGGAACTCTTGCTGG - Intergenic
1044963892 8:97556960-97556982 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1045096192 8:98800633-98800655 CACCCACCCGGAACTCGTGCTGG - Intronic
1045232352 8:100317095-100317117 CGCCCACCCGGAACTCCAGCTGG + Intronic
1045407414 8:101880319-101880341 CGCCCACCCAGAACTCATGCTGG + Intronic
1045467790 8:102485826-102485848 CGCCCACTCGGAACTCCAGCTGG + Intergenic
1046149376 8:110202885-110202907 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1046260344 8:111759070-111759092 CGCCCACACGGAACTCGCGCTGG + Intergenic
1046265419 8:111823597-111823619 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1046285066 8:112083249-112083271 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1046288877 8:112132738-112132760 CGCCCGCCCGCAACTCCAGCTGG - Intergenic
1046445307 8:114311397-114311419 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1046450686 8:114386202-114386224 CGCCCACCCGGAACTTCAGCTGG - Intergenic
1046621193 8:116531133-116531155 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1046661228 8:116950050-116950072 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1047100201 8:121667727-121667749 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1047124710 8:121948082-121948104 CGCCCACCCGGAACTCTAGCTGG - Intergenic
1047631734 8:126714951-126714973 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1048112834 8:131487091-131487113 AGCCCACCCGGAACTCGCGCTGG - Intergenic
1048186909 8:132249971-132249993 TGCCCACCCGGAACTTGCGCTGG + Intronic
1048576046 8:135690701-135690723 CGCCCACCCAGAACTCGCGCTGG + Intergenic
1048655435 8:136530724-136530746 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1048757530 8:137755435-137755457 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1048789143 8:138084181-138084203 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1049087668 8:140490829-140490851 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1049157682 8:141076733-141076755 CGCCCACCCGGAACTCACACTGG - Intergenic
1049500284 8:142959523-142959545 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1049857914 8:144875216-144875238 TGCCCACCCGGAACTCACGCTGG - Intergenic
1050249931 9:3733858-3733880 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1050294884 9:4195343-4195365 CGCCCACCCAGAACTCGCGCTGG - Intronic
1050920592 9:11196925-11196947 CGCGCACCTGGAACTCCAGCTGG - Intergenic
1050975273 9:11929169-11929191 CGCCCACCCAGAACTCACACTGG + Intergenic
1051305119 9:15700356-15700378 CGCCCACCCGGAACTCCAGCTGG + Intronic
1051383275 9:16480554-16480576 CGCCCACCCGGAACTCCAGCTGG - Intronic
1051439832 9:17072651-17072673 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1051449429 9:17178699-17178721 CACCCACCCGGAATTCACGCTGG + Intronic
1051459456 9:17295144-17295166 CGCCCACCCGGAACTCTAGCTGG + Intronic
1051463773 9:17353981-17354003 CGCCCACCCGAAACTCCAGCTGG - Intronic
1051549801 9:18315644-18315666 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1051892669 9:21959297-21959319 CGCCCACCCGGAACTCCAGCTGG - Intronic
1051929080 9:22363787-22363809 CGCCCACCCGGAACTTGCCCTGG + Intergenic
1052014822 9:23452081-23452103 AGCCCACCCAGAACTCACGCTGG - Intergenic
1052075426 9:24135132-24135154 CGCCCATCTGGAACTCCAGCTGG - Intergenic
1052122765 9:24738573-24738595 CGGCCACCCGGAACTTGCGCTGG - Intergenic
1052313410 9:27092700-27092722 CGCCCACCCGGAACTCGTGCTGG - Intergenic
1052979516 9:34437970-34437992 CGCCCACTCGGAACTCCAGGTGG - Intronic
1052985377 9:34483079-34483101 CGCCCACCCGGAACTCCAGCTGG + Intronic
1053027315 9:34740551-34740573 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1053393379 9:37751924-37751946 CGCCCACCCGGAACTCTAGCTGG - Intronic
1053436072 9:38075423-38075445 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1053475220 9:38377624-38377646 CGCCCACCCGGAACTCCCGCTGG - Intergenic
1053547945 9:39042672-39042694 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1053812065 9:41862713-41862735 TGCCCACCCAGAACTCCAGCTGG + Intergenic
1054618530 9:67324726-67324748 TGCCCACCCAGAACTCCAGCTGG - Intergenic
1054722419 9:68617069-68617091 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1055049332 9:71963585-71963607 CGCCCACCCGGAACTCCAGCTGG - Intronic
1055102595 9:72480516-72480538 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1055248625 9:74276245-74276267 AGCCCACCCGGAACTCGCGCTGG + Intergenic
1055461480 9:76524004-76524026 TACCCACCCGGAACTCGCGCTGG + Intergenic
1055557607 9:77490697-77490719 CGCCCACCCGGAACCCCAGCTGG + Intronic
1055651346 9:78410043-78410065 CGCCCACCCAGAACTCCAGTTGG - Intergenic
1055654905 9:78442116-78442138 CACCCACTCGGAACTCGCGCTGG - Intergenic
1055814194 9:80185611-80185633 CGCCCACCCGGAACTCTAGCTGG + Intergenic
1055925594 9:81507419-81507441 CGCCCACCTGGAACTCGCGCTGG - Intergenic
1056080994 9:83093621-83093643 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1056305735 9:85289093-85289115 TGCCCACCCGGAACTCTAGCTGG - Intergenic
1056677266 9:88686229-88686251 CGCCTACCTGGAACTCGCGCTGG + Intergenic
1056735914 9:89209448-89209470 CGCCCGCCCAGAACTCGCGCTGG - Intergenic
1056743720 9:89282471-89282493 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1056771425 9:89480733-89480755 CGCCCACCCGGAACTCCAGCTGG + Intronic
1057118143 9:92545317-92545339 CGCCCACCCAGAACTCTAGCTGG - Intronic
1057300681 9:93879987-93880009 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1057383950 9:94591458-94591480 CGCCCACCCGGAACTCCAGCTGG + Intronic
1057511108 9:95680376-95680398 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1057543888 9:96002034-96002056 CGCCCACCTGGAACTCCAGCTGG + Intronic
1057628668 9:96701232-96701254 CGCCCACCCGGAACTGCAGCTGG + Intergenic
1057689532 9:97271391-97271413 CGCCCACCCGGAACCCGCACTGG + Intergenic
1057726891 9:97574264-97574286 CGCCCACCCGGAACACGCGCTGG - Intronic
1058235711 9:102487254-102487276 CGCCCACCCGGAACTCACGCTGG + Intergenic
1058286538 9:103186958-103186980 CGCCCACGCGGAACTCCAGCTGG - Intergenic
1058365158 9:104200640-104200662 CGCCCACCTGGAACTTGCGCTGG - Intergenic
1058379592 9:104363215-104363237 CGCCCACCCAGAACTCACGTTGG + Intergenic
1058585395 9:106501606-106501628 CGCCCACCTGGAAATCGCGCTGG + Intergenic
1058727495 9:107817839-107817861 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1058786465 9:108393551-108393573 CGCCCATCCGGAACTCCAGCTGG - Intergenic
1059791180 9:117643042-117643064 CGCCTACCCGGAATTCACGCTGG + Intergenic
1059891472 9:118809530-118809552 CGCCTACCCGGAACTCGCGCTGG + Intergenic
1059991590 9:119870597-119870619 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1060091327 9:120746425-120746447 CGCCCACGCGGAACTCGCGCTGG - Intergenic
1060594260 9:124839036-124839058 CACCCATCCGGAACTCCAGCTGG + Intergenic
1061483798 9:130910166-130910188 TGCCCACCTGGAACTCCAGCTGG - Intronic
1061877687 9:133553074-133553096 CGGCCACGCGGGCCTCCCACAGG - Intronic
1062146239 9:134991346-134991368 CCCCCACCCGGAAGTCCAGCTGG + Intergenic
1203460452 Un_GL000220v1:31300-31322 CGCCCACCCGGAACTCGCGTTGG + Intergenic
1203471288 Un_GL000220v1:116439-116461 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1203479109 Un_GL000220v1:160411-160433 CCCCCACGCGGCGCTCCCCCGGG - Intergenic
1203662901 Un_KI270753v1:61685-61707 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1203670470 Un_KI270755v1:7012-7034 CGCCCACCGGGAACTCGTGCTGG - Intergenic
1186282106 X:8003586-8003608 CGCCCACCCAGAACTCTAGCTGG + Intergenic
1186293162 X:8121634-8121656 CGCCCACCCGGAACTCGCGCTGG - Intergenic
1186323282 X:8452806-8452828 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1187005872 X:15232046-15232068 CCCCCACCCAGAACTCCAGCTGG + Intergenic
1187139017 X:16575499-16575521 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1187304579 X:18083848-18083870 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1187557605 X:20367165-20367187 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1187903987 X:24049737-24049759 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1188166981 X:26873975-26873997 CGCCCACCTGGAACTCACGCTGG + Intergenic
1188189500 X:27157050-27157072 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1188881784 X:35499321-35499343 GCCCCACCGGGAACTCCCGCTGG - Intergenic
1189467144 X:41286023-41286045 CGCCCACCCAGAGCTCACGCTGG + Intergenic
1190045901 X:47111319-47111341 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1190413997 X:50163645-50163667 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1191053934 X:56222867-56222889 CGCCCACCCGGAATTCTAGCTGG + Intergenic
1191618666 X:63192885-63192907 CGCCCATCCGGAACTCCAGGTGG + Intergenic
1192186736 X:68952206-68952228 CGTCCACCTGGAACTCCAGCTGG - Intergenic
1192251375 X:69416814-69416836 TGCCCACCCGGAACTCGCGCTGG - Intergenic
1192869689 X:75173913-75173935 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1192870595 X:75179833-75179855 CACCTACCCGGAACTCCAGCTGG + Intergenic
1193271036 X:79530619-79530641 CGCTCACCCGGAACTCTAGCTGG - Intergenic
1193538189 X:82738519-82738541 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1193804076 X:85972673-85972695 CGCCCACCCGGAACTCCAGCTGG + Intronic
1194025612 X:88746641-88746663 CGCCCACCCGGAACTCGTGCTGG + Intergenic
1194071626 X:89331345-89331367 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1194118060 X:89926850-89926872 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1194121233 X:89965961-89965983 CGCCTACCCGGAACTCCAGCTGG + Intergenic
1194166315 X:90521380-90521402 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1194204443 X:90995468-90995490 CGCCCACCCGGGACTTGCGCTGG - Intergenic
1194340478 X:92699795-92699817 CGCTCACCCAGAACTCACGCTGG + Intergenic
1194650854 X:96512567-96512589 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1194890508 X:99372351-99372373 CGCCCCCCCGGAACTGGCGCTGG + Intergenic
1195256290 X:103094159-103094181 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1195258060 X:103107665-103107687 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1195259384 X:103117374-103117396 CGCCCACCCAGAACTCCAGCCGG + Intergenic
1195460283 X:105116023-105116045 CGCCCACCCAGAACTTGCGCTGG + Intronic
1195896396 X:109749634-109749656 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1195909626 X:109876164-109876186 CGCCCACCTGGAACTCGCGCTGG + Intergenic
1196197949 X:112855170-112855192 CGCCTACCCGGAACTCATGCTGG + Intergenic
1196319564 X:114270875-114270897 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196582663 X:117394726-117394748 CGCCCACTCGGAACTCCAGCTGG - Intergenic
1196616118 X:117769113-117769135 AGCCCACCCGGAACTCGCGCTGG - Intergenic
1196705947 X:118717255-118717277 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196714582 X:118799001-118799023 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1196728964 X:118922300-118922322 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1196741314 X:119028530-119028552 CGCCCACCTGGAACCCACGCTGG + Intergenic
1196741489 X:119029559-119029581 CGCCCACCGGGAACTCCAGCTGG - Intergenic
1196762008 X:119208788-119208810 CGCCCACGGGGAACTCCAGCTGG + Intergenic
1196762375 X:119211195-119211217 CGCCCACGGGGAACTCCAGCTGG + Intergenic
1196775174 X:119331919-119331941 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1196775475 X:119333640-119333662 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1196781494 X:119387900-119387922 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1196794012 X:119488179-119488201 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1196827308 X:119751144-119751166 CGCCCACCCAGAACTCCAGCTGG + Intergenic
1196845027 X:119890636-119890658 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1196860891 X:120026101-120026123 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1197000319 X:121431844-121431866 CGCCCACCCGAAACTCCAGCTGG + Intergenic
1197340020 X:125255692-125255714 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1197376832 X:125690895-125690917 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1197533801 X:127663285-127663307 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1197607895 X:128606650-128606672 CGCCCACCCGGAACTCTCGCTGG - Intergenic
1197978729 X:132194131-132194153 CACCCACCCGGATCTCGCGCTGG - Intergenic
1198060888 X:133044422-133044444 TGCCCACCCGGAACTCTAGCTGG - Intronic
1198664341 X:139004341-139004363 CGCCCACCCGGAACTCCAGCTGG + Intronic
1198972623 X:142298561-142298583 CGTCCACCCGGAACTCCAGCTGG + Intergenic
1199009972 X:142746039-142746061 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1199028828 X:142972452-142972474 CGCCCACCCGTAACTCCAGCTGG + Intergenic
1199050258 X:143229006-143229028 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1199134193 X:144231525-144231547 CGCCCACCCGGAACTCGCGCTGG + Intergenic
1199175510 X:144783678-144783700 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1199285122 X:146046471-146046493 CGCCCACCCGGAACACGCACTGG + Intergenic
1199356279 X:146867197-146867219 CGCCCACCTGGAACTCCAGCTGG + Intergenic
1199831315 X:151551503-151551525 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1199831807 X:151555466-151555488 CACCCACCCGGAACTCGTGCTGG + Intergenic
1199833054 X:151563095-151563117 CGTCCACCCGGAACTTGCGCTGG + Intergenic
1200100221 X:153686457-153686479 CGCCCACCCCGCACTCCTGCTGG + Intronic
1200423593 Y:2998691-2998713 TGCCCACCCGGAACTCCAGCTGG + Intergenic
1200470939 Y:3584419-3584441 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1200474090 Y:3623412-3623434 CGCCTACCGGGAACTCCAGCTGG + Intergenic
1200512584 Y:4099161-4099183 TGCCCACCCGGAACTCCAGCTGG - Intergenic
1200550284 Y:4570909-4570931 CGCCCACCCGGGACTTGCGCTGG - Intergenic
1200725869 Y:6667074-6667096 CACCCACCCGGAACTCCAGCTGG + Intergenic
1200824328 Y:7622532-7622554 CGCCCACCCGGAACCCCAGCTGG + Intergenic
1200829062 Y:7673177-7673199 CGCCCACCCGGAACTCGCTCTGG - Intergenic
1200888650 Y:8298662-8298684 CGCCCACCCAGAACTCCAGCTGG - Intergenic
1201423074 Y:13820520-13820542 CACCCACCCGGAACTCCAGCTGG + Intergenic
1201424220 Y:13831395-13831417 TGCCCACCCAGAACTCACGCTGG - Intergenic
1201429167 Y:13887906-13887928 CGCCCACCCTGAACTTGCGCTGG - Intergenic
1201430496 Y:13897283-13897305 CGCCCACCGGGAACTTGCGCTGG - Intergenic
1201468316 Y:14309332-14309354 CGCCCACCTGGAACTCATGCTGG - Intergenic
1201479904 Y:14428135-14428157 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1201495719 Y:14590099-14590121 CGCCCACCCGGAACTCCAGCTGG + Intronic
1201496963 Y:14598512-14598534 CGCCCACCCAGAACTCCAGCTGG + Intronic
1201499610 Y:14627608-14627630 GGCCCACCCAGAACTCGCGCTGG + Intronic
1201573003 Y:15433889-15433911 CACCCACCCAGAACTCCAGCTGG - Intergenic
1201715774 Y:17043152-17043174 CGCCCACCCGGAACTCCAGCTGG - Intergenic
1201885758 Y:18880220-18880242 CGCCCACCCAGAACTCCTGCTGG - Intergenic
1201982650 Y:19924031-19924053 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1202109811 Y:21407246-21407268 CGCCCACCTGGAACTCCAGCTGG - Intergenic
1202137127 Y:21676978-21677000 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1202202451 Y:22367475-22367497 CGCCGACCCAGAACTCCTGCTGG + Intronic
1202235727 Y:22708555-22708577 CGCCCACCCGGAACCCCAGCTGG - Intergenic
1202272687 Y:23086078-23086100 CACCCACCCGGAACTCAAGCGGG + Intergenic
1202293339 Y:23334604-23334626 CACCCACCCGGAACTCAAGCGGG - Intergenic
1202307436 Y:23487613-23487635 CGCCCACCCGGAACTCCAGCTGG + Intergenic
1202425684 Y:24719822-24719844 CACCCACCCGGAACTCAAGCGGG + Intergenic
1202445105 Y:24950263-24950285 CACCCACCCGGAACTCAAGCGGG - Intergenic
1202563369 Y:26182973-26182995 CGCCCACCCGGAACCCCAGCTGG - Intergenic