ID: 951151343

View in Genome Browser
Species Human (GRCh38)
Location 3:19293611-19293633
Sequence ATGAATTAGCTTAATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951151343 Original CRISPR ATGAATTAGCTTAATCTGGA TGG (reversed) Intronic
902393602 1:16120154-16120176 ATTAATTAGCAAATTCTGGAGGG - Intergenic
904367711 1:30025998-30026020 AGGAATTAGCTTAACCAAGAAGG + Intergenic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
907359827 1:53905542-53905564 ATGAATTAGAATCATCTGGAAGG + Intronic
907771445 1:57468963-57468985 GTGAATAAGTTTAATGTGGAGGG - Intronic
909002082 1:70230334-70230356 GTGTAATAGCTAAATCTGGAGGG - Intronic
912119236 1:106449716-106449738 AGGAATTAACTTAATCAGGGAGG - Intergenic
912847522 1:113088584-113088606 ATGAAAGCCCTTAATCTGGAAGG + Intronic
913478448 1:119261439-119261461 CTGTATTAGCTGAATCTGTAAGG - Intergenic
913576555 1:120180986-120181008 ATGAAATAGCTTCTTCTAGAAGG - Intergenic
914558462 1:148792421-148792443 ATGAAATAGCTTCCTCTAGAAGG - Intergenic
914614373 1:149337809-149337831 ATGAAATAGCTTCCTCTAGAAGG + Intergenic
915771070 1:158424789-158424811 TTGAAATAGCTTTATCTGGAAGG - Intergenic
916175980 1:162038887-162038909 AAGAAATAGCTCCATCTGGAGGG - Intergenic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
918510593 1:185309766-185309788 ATGAATTTGCTTAATGGGCATGG - Intronic
919862058 1:201746367-201746389 ATGATTTAACCTAATCTGAAGGG - Intronic
920808569 1:209258794-209258816 ATGAATTATTATAATCTGAAAGG + Intergenic
921402611 1:214742897-214742919 ATGACTAAGCTTAATGAGGAAGG - Intergenic
922333165 1:224595617-224595639 ATGATTTAGCTTAGTGAGGAAGG + Intronic
922389533 1:225125828-225125850 ATGATTAAGCTTAATAAGGAAGG - Intronic
922643783 1:227263920-227263942 AAGAATGAGTGTAATCTGGATGG + Intronic
1064372783 10:14768077-14768099 AGGAATTAGCTTAACCTAGGAGG + Intronic
1064408003 10:15081416-15081438 GTAAATTTACTTAATCTGGATGG - Intronic
1066063778 10:31747611-31747633 ATAAAGTTGCTTAATCTGAATGG + Intergenic
1066463985 10:35637854-35637876 ATGAATAGGGTTAATCTGTAGGG - Intergenic
1068241360 10:54305693-54305715 ATGAATTATCTAATTCTTGAGGG + Intronic
1070804388 10:79262347-79262369 ATGCATTAGAATAATCTGGAAGG - Intronic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072344468 10:94489620-94489642 ATGAGTAAGCTTAATGAGGAAGG - Intronic
1072709130 10:97704312-97704334 ATAAATTAGCTGGCTCTGGAGGG + Intergenic
1073803667 10:107071614-107071636 AGGAAGTAGATTAATCTAGAGGG - Intronic
1074263021 10:111872864-111872886 CTGAATTTGCTTAACCAGGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075593305 10:123708324-123708346 ATGAAATATCTAAAACTGGATGG - Intronic
1075607748 10:123826484-123826506 ATGAATCAGCTAAAATTGGAAGG + Intronic
1078245126 11:9567351-9567373 ATTAATTTACTTAATATGGATGG - Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082285659 11:50315472-50315494 GTGAATGAGCTGAATGTGGAAGG + Intergenic
1082940933 11:58704317-58704339 TTGAATTTGCTTCATTTGGATGG - Intronic
1083556145 11:63630049-63630071 ATGAAGTAAATTAATCTAGAGGG + Intronic
1085577159 11:77616496-77616518 ATGAATTAACTTAACCAAGAGGG - Exonic
1086134199 11:83430537-83430559 GTAAATTTACTTAATCTGGATGG - Intergenic
1086477597 11:87195167-87195189 ATAAATTACCTAAATTTGGATGG - Intronic
1086533718 11:87816884-87816906 ATGTATTAGAATCATCTGGAAGG - Intergenic
1086560783 11:88166503-88166525 ATGAGCAAGCTTGATCTGGAAGG - Intronic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1087586186 11:100124920-100124942 ATGCATAAAATTAATCTGGATGG + Intronic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1089925701 11:122255327-122255349 AGGAATTAGCTAACCCTGGAAGG - Intergenic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1093074179 12:14740185-14740207 GTGAATTTACTTAACCTGGATGG + Intergenic
1093155479 12:15679178-15679200 ATGAATTTGATGAATATGGATGG - Intronic
1093286177 12:17267024-17267046 ACGAATTACCATAATCTGGAGGG - Intergenic
1095214663 12:39534055-39534077 ATGCATTAGCTTAAAATGGGTGG - Intergenic
1095697623 12:45158641-45158663 ATAAACTAGCATAAGCTGGATGG - Intergenic
1095797330 12:46234304-46234326 AGGGAGTAGCTTAAGCTGGAGGG + Intronic
1095912360 12:47441609-47441631 AGGAATTATCTTAAGATGGAGGG - Intergenic
1097359238 12:58640189-58640211 ATGAATTATATTAGTATGGATGG + Intronic
1097531203 12:60801893-60801915 GTGATATAGCTTAACCTGGAAGG + Intergenic
1097612566 12:61842463-61842485 ATGAATTGTCTAAATCTGTATGG + Intronic
1099128378 12:78795153-78795175 ATGATTCAACTTAATCAGGAAGG + Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1104165155 12:126221162-126221184 ATGATTTAGCTTACTGAGGAAGG + Intergenic
1108121178 13:47189209-47189231 ATGAATTAGAGTTTTCTGGAGGG - Intergenic
1108909245 13:55522368-55522390 ATGATTAAGCTTAGTCAGGAAGG - Intergenic
1109350491 13:61174310-61174332 ATGACTAAGCTTAATGGGGAAGG + Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110669969 13:78166289-78166311 ATAAATTAGCTGAATGTGGTGGG - Intergenic
1111121523 13:83857542-83857564 ATGAGTTTGCTAAATCTGCATGG - Intergenic
1111194281 13:84852310-84852332 ATGAATTTGCTTGATTTGGCAGG + Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111575792 13:90152975-90152997 ATGATTGAGCTTAATGAGGAAGG - Intergenic
1111787385 13:92806524-92806546 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1115953546 14:38749255-38749277 AAGAACAAGCTTAATCAGGATGG + Intergenic
1118480926 14:66164679-66164701 AGGAATTAGCTAATTCTGGAAGG + Intergenic
1118921485 14:70153390-70153412 ATGAATTAGCTTCAGCTTGTGGG - Intronic
1119752692 14:77091343-77091365 ATGAATTTCATAAATCTGGAAGG + Intergenic
1120243683 14:81980742-81980764 ATGAAGTAGTATAGTCTGGATGG - Intergenic
1121725146 14:96141821-96141843 AGGAATTAGCTAAACCTGGAAGG + Intergenic
1124195256 15:27619776-27619798 AACAATTAACTTAATTTGGAGGG + Intergenic
1124866197 15:33493727-33493749 ATGTATAAGCTTGTTCTGGAAGG - Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1130794729 15:87196104-87196126 CCCAATTAGCTTAATCTGAAGGG + Intergenic
1131501326 15:92969723-92969745 ATGAATTAGCTTGGTGTGGTTGG - Intronic
1135177330 16:20242237-20242259 ATGAATGAGCTGAAAATGGAAGG - Intergenic
1137450318 16:48567819-48567841 AGGAATTAGCTGGCTCTGGAAGG - Intronic
1138641478 16:58391458-58391480 AGGAATTAGCTAACTCTGAAAGG + Intronic
1138986307 16:62332988-62333010 AGGAATGAGGTTAATCTGCAGGG + Intergenic
1139159597 16:64488449-64488471 ATAATTTATATTAATCTGGAAGG + Intergenic
1139176333 16:64693082-64693104 ATAAATTAGCATAATCTGGAGGG + Intergenic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145726879 17:27137398-27137420 ATGATTGAGCTTAATGAGGAAGG + Intergenic
1146225261 17:31060559-31060581 ATGAATTAGCCTCTTCTAGATGG - Intergenic
1146394574 17:32453566-32453588 TTGAATTAGCATTCTCTGGAGGG + Intronic
1146695884 17:34908942-34908964 ATGAATTAGCTGCTTCTGGCTGG + Intergenic
1149299019 17:55287059-55287081 ATGCATTAGCTCAATCAGGGGGG + Intronic
1149299429 17:55290739-55290761 ATGAGTAAGCTTAATTTTGAAGG + Intronic
1150354005 17:64467996-64468018 TGGCATTAGCTAAATCTGGAGGG - Intronic
1150360388 17:64527713-64527735 ATGAATGAGCTGGATCTGTAAGG - Intronic
1152040262 17:77898419-77898441 ATGAATTACCTTCATCAGAAGGG + Intergenic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155740968 18:29287072-29287094 ATGAAGCAGCTTTCTCTGGATGG + Intergenic
1155837891 18:30610088-30610110 ATGCATTAGTTTAGTCTGCATGG + Intergenic
1157767923 18:50316143-50316165 ATCAATTTACTTAATCTTGAGGG - Intergenic
1158869382 18:61669894-61669916 ATAAATTAGCACAAGCTGGATGG + Intergenic
1159137757 18:64356998-64357020 ATGAAGTAGCATAGACTGGATGG + Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1164881499 19:31735956-31735978 ATGAATTAAATTAAGTTGGATGG - Intergenic
1167944055 19:52973294-52973316 AAGAAATAGCTTAAACTGGGAGG - Intergenic
1167993240 19:53378547-53378569 AAGAAATAGCTTAAACTGGGAGG + Intronic
1168015194 19:53567437-53567459 ATAGATTAGCTAACTCTGGATGG - Intronic
925687632 2:6489771-6489793 ATGAAATTGGTTTATCTGGACGG - Intergenic
928433101 2:31236339-31236361 ATGGATTAGTTTAATCTCTAAGG - Intronic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931151363 2:59577439-59577461 TTGAATTAACTCAACCTGGAGGG - Intergenic
931506252 2:62930304-62930326 AGGAATTAACTTGATCAGGAAGG + Intronic
933104142 2:78301361-78301383 GTGAATCAGCTTAATTGGGAAGG + Intergenic
937818547 2:126281155-126281177 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
938286532 2:130122011-130122033 AAGAATTTGCCTATTCTGGAAGG + Intronic
938429068 2:131216855-131216877 AAGAATTTGCCTATTCTGGAAGG - Intronic
938469970 2:131550934-131550956 AAGAATTTGCCTATTCTGGAAGG - Intergenic
939365588 2:141226275-141226297 ATGTATTAGGTAAAGCTGGATGG - Intronic
939635794 2:144581266-144581288 TTGGTTTACCTTAATCTGGAGGG - Intergenic
941552092 2:166929180-166929202 ATGCATTAGAATCATCTGGAGGG - Intronic
942593297 2:177568447-177568469 ATTAATTAGCTAGACCTGGAAGG + Intergenic
942747804 2:179255251-179255273 ATGATTAAGCTTACTCAGGAAGG + Intronic
943721627 2:191209069-191209091 ATGACTTAGCCTGAACTGGATGG - Intergenic
945020085 2:205561865-205561887 ATGAAAAAGCTTAATTTGGTGGG - Intronic
945819878 2:214650945-214650967 ATAAATTAGCTAAAGCTGGTTGG + Intergenic
945843480 2:214915658-214915680 TTAAATGAGCTTAATGTGGAAGG + Intergenic
947434747 2:230063443-230063465 ATAAATTAACTGAATCTTGAAGG - Intronic
948336278 2:237209696-237209718 ATGATTTACCTTTTTCTGGAAGG - Intergenic
1172855177 20:37996248-37996270 AAGAATTATCTTAACCTGGCAGG + Intronic
1175063922 20:56269295-56269317 TTGAATTAGCTTAATTTAAAAGG - Intergenic
1178427696 21:32492102-32492124 AGGAATGAGCTTACTCTGGGTGG + Intronic
1178697554 21:34807614-34807636 ATGACTGAGGTGAATCTGGAGGG - Intronic
1183221582 22:36517375-36517397 AGGAATTACCTTCATCTTGAGGG + Exonic
949396152 3:3616676-3616698 AGGAATTAGCTTACTATGGGAGG - Intergenic
951151343 3:19293611-19293633 ATGAATTAGCTTAATCTGGATGG - Intronic
951306643 3:21071265-21071287 ATGATTCAGCTTAATGAGGAAGG + Intergenic
951792972 3:26507034-26507056 ATGAATTTTCTTAATGAGGATGG + Intergenic
955682549 3:61517606-61517628 ATGGATTTGCTTATTCTAGATGG - Intergenic
956094922 3:65706311-65706333 ATGAATGAGCTAAATCTGAGCGG + Intronic
956143344 3:66167760-66167782 ATGCATTAGCTTAATGTCAAGGG - Intronic
956325481 3:68047910-68047932 ATCCATTCGCATAATCTGGAAGG - Intronic
956744011 3:72297308-72297330 ATGCATCAGCATCATCTGGAAGG - Intergenic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957661252 3:83156323-83156345 ATGCATTAGAATAACCTGGAAGG - Intergenic
957892428 3:86377551-86377573 ATGAAGTTGCTTATTCTGGGTGG - Intergenic
958917507 3:100066013-100066035 GTGCATTAGAATAATCTGGAAGG - Intronic
959282357 3:104360896-104360918 ATGACTGAGTTTAATCTAGAAGG + Intergenic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960263482 3:115594089-115594111 AGGAATTAGCTAGCTCTGGAAGG + Intergenic
961317070 3:126046533-126046555 ATGAATTAACTTAACCAAGAAGG + Intronic
961761345 3:129171002-129171024 ATGAATTAGCTATAAATGGAAGG - Intronic
962085930 3:132191379-132191401 AAGAATTAGCTAACTCTGGGAGG - Intronic
962131071 3:132677320-132677342 AAGAATGAGTGTAATCTGGATGG - Exonic
963441624 3:145346933-145346955 ATGAACAAGGTTAATTTGGAAGG + Intergenic
963507379 3:146203968-146203990 ATGATTTAGCTTAATGAGGAAGG - Intronic
963562152 3:146879288-146879310 ATGAATTTGGTAAAACTGGAAGG + Intergenic
963880033 3:150518677-150518699 CTCTATTATCTTAATCTGGAAGG + Intergenic
964557613 3:157957215-157957237 ATAAATTGTCTTAATCTGTAAGG - Intergenic
964965194 3:162482997-162483019 AGGAATAAGCTAAATCTAGAAGG - Intergenic
967625973 3:191684112-191684134 AGGAATTAACTTTCTCTGGAAGG - Intergenic
970751031 4:19361680-19361702 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
971729505 4:30359779-30359801 ATGAAAAAGCTTAATTTGGCTGG + Intergenic
972699775 4:41482884-41482906 ATGATTTAGCTTATGCTGGGGGG + Intronic
974542219 4:63251658-63251680 ATGAATTATGTTGATCTAGAGGG - Intergenic
977194434 4:94042029-94042051 ATGATTTAGCTTAGTGAGGAAGG - Intergenic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
978963301 4:114710352-114710374 GTGGATTAGCTTTAGCTGGATGG - Intergenic
979134094 4:117086492-117086514 ATGAATTAGCTTTATCCTTAGGG - Intergenic
979268105 4:118726845-118726867 AGTAATTAGCATAACCTGGAAGG + Intronic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979471710 4:121106803-121106825 ATGCATGAGCTTAATTTTGAAGG + Intergenic
979567375 4:122169957-122169979 ATGAATTTGTTTAATGTAGATGG + Intronic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
980944248 4:139303112-139303134 ATGAATTCACTAAATCTGTAGGG - Intronic
982189242 4:152836664-152836686 ATGAATGAGTTTAATGTGCAAGG - Intronic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985916941 5:2929308-2929330 AATAATTAGCTGGATCTGGAGGG - Intergenic
990714870 5:58625470-58625492 ATGAAAGAGATTAATCTGGATGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
991326707 5:65441560-65441582 ATCAATTAGATTAATTTGGGTGG - Intronic
994026431 5:95089715-95089737 ATGAACTACATTAAACTGGAGGG - Intronic
994921113 5:106045305-106045327 ATGAATTTGCTTAAGCTTAATGG - Intergenic
995281867 5:110344879-110344901 AAGAATTAACTTGATCTGAAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
997123811 5:131204852-131204874 ATGATTAATCTTAATCGGGAAGG + Exonic
997801476 5:136866863-136866885 TTGAATTAGCTAAATATGGTTGG - Intergenic
999005318 5:147970044-147970066 ATTAAGTAGCTTAGTTTGGAGGG + Intergenic
999688029 5:154119744-154119766 ATAATTAAGCTTAATGTGGATGG + Intronic
999841242 5:155429852-155429874 AAGAATTAGTTTAAGCTGGGTGG + Intergenic
1001226340 5:169947578-169947600 AAGCATCAGCTTAATGTGGAGGG - Intronic
1001860636 5:175051776-175051798 ATGTCTTAGCATCATCTGGAGGG + Intergenic
1003003652 6:2360712-2360734 ATAAATATGCTTAATCTAGATGG - Intergenic
1006966397 6:37990073-37990095 CTGAATCAGCATCATCTGGAGGG + Intronic
1008383757 6:50863306-50863328 ATGAATTAGCATATTTTGAAGGG + Intergenic
1008731217 6:54484849-54484871 ATGAATTAACTTAACCAAGAGGG - Intergenic
1009484984 6:64210134-64210156 ATAAATTAGCTTATTCAGAAAGG - Intronic
1010155345 6:72785775-72785797 ATGATTTAGCTTCAACTTGAAGG - Intronic
1011372934 6:86658811-86658833 ATGACATGGATTAATCTGGAAGG + Intergenic
1012073408 6:94653107-94653129 AAGAATTCACGTAATCTGGAGGG - Intergenic
1012520121 6:100111127-100111149 AAGAACTACCTGAATCTGGAGGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013464609 6:110406800-110406822 ATGAAACACCTTGATCTGGATGG + Intronic
1013716206 6:112966249-112966271 ATGGATTAGTTTTATCTGGCTGG - Intergenic
1014595063 6:123325774-123325796 TTGAATTAACTTATTCTGAAAGG + Intronic
1014975539 6:127877407-127877429 ATGATTAAGCTTAGTGTGGAAGG - Intronic
1015204475 6:130619064-130619086 GTGAATTTACTTAATCTAGATGG - Intergenic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1016428890 6:143962720-143962742 GTGAATGAGCTGAAACTGGAAGG - Intronic
1016595533 6:145794485-145794507 ATGAAATAACTTACTCTGAATGG - Exonic
1017142907 6:151207861-151207883 ATAAATTAGCATACTCTTGAAGG + Intergenic
1021952756 7:25791188-25791210 ATGGATTAGCGAAAGCTGGAGGG - Intergenic
1022469267 7:30672144-30672166 ATGAATTAGCTTGACCTCAATGG - Intronic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1024357909 7:48435218-48435240 AAGAATTAACTTAATCATGAGGG - Intronic
1026274559 7:68865210-68865232 AAAAATTAGCTGAACCTGGAAGG - Intergenic
1026415349 7:70174018-70174040 ATGATTTAGCTTAGTAAGGAAGG + Intronic
1029242960 7:99177483-99177505 AAGAATCAACTGAATCTGGAAGG + Intronic
1030478894 7:110076890-110076912 TTGAATTAGCATAATTTGTAAGG + Intergenic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1031558743 7:123210822-123210844 ATGAATTAGAGTCACCTGGAAGG - Intergenic
1031645859 7:124224150-124224172 ATGTATTATCTTATTCTGGTTGG - Intergenic
1031686548 7:124737028-124737050 ATGAATTAGGTGAATTAGGATGG - Intergenic
1034873254 7:154702346-154702368 ATGAGTAAGCTTAATGAGGAAGG + Intronic
1035939260 8:3877436-3877458 ATGAATTCTCTTAATCTAGCAGG + Intronic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037779302 8:21856717-21856739 ATAATTGAGCTTAATGTGGATGG - Intergenic
1037919095 8:22791335-22791357 ATGAATTTGCTTTATTTGTACGG - Intronic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1041450838 8:58005078-58005100 ATGATTTTGCTTAATGAGGAAGG - Intronic
1042419401 8:68567885-68567907 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042745817 8:72104391-72104413 ATAAATTTACTTAATCTAGATGG + Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1044668996 8:94659592-94659614 ATGATTAAGCTTAGTCAGGAAGG + Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1046080718 8:109367214-109367236 ATGAATGAACTTAATTTGGAGGG + Intronic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046728307 8:117698063-117698085 TTGAATTAGCTCAATCTGGCTGG - Intergenic
1050565093 9:6873819-6873841 ATGATTTAGCTTAGTAAGGAGGG - Intronic
1051426337 9:16935172-16935194 ATAAATTAGCTTAGCCTGGCTGG - Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1053515013 9:38723181-38723203 AGGAATTAGCTTGCCCTGGAGGG + Intergenic
1055268921 9:74533598-74533620 AAAAATTAGTTTAATCTGGTTGG + Intronic
1057378721 9:94548353-94548375 AAGAATTTGCCTATTCTGGAAGG + Intergenic
1057927361 9:99165409-99165431 AAGGATTAGATTAATCTGTATGG + Intergenic
1058852316 9:109024845-109024867 ATGTGTTAGCTTTATCTTGAAGG + Intronic
1059019668 9:110561513-110561535 ATGTATTAGTTTATTCTGCATGG - Intronic
1062260843 9:135662607-135662629 GTAAATTTACTTAATCTGGAGGG - Intergenic
1185790612 X:2926209-2926231 GTGAATTGACTTAATCTAGATGG + Intronic
1186038031 X:5445749-5445771 AGTAATTGGCTTAATCTAGATGG - Intergenic
1186254646 X:7705153-7705175 ATCATTTAGCTTAAGGTGGATGG + Intergenic
1187112974 X:16320450-16320472 ATGAATTGGCTTTATCTGTGTGG - Intergenic
1187791042 X:22950708-22950730 CTGAATTATTTTAATATGGAGGG - Intergenic
1188518475 X:31012668-31012690 AGGAATTAGCTAACCCTGGAAGG - Intergenic
1188720774 X:33520562-33520584 TTGAATTAGCTTAGTTTGAACGG + Intergenic
1188818588 X:34745522-34745544 ACAAATTACCTTAAACTGGAGGG - Intergenic
1189956384 X:46278758-46278780 ATGAATAAGGTTAAACTGAAAGG - Intergenic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1193374097 X:80737536-80737558 ATTAAAAAGCTTAATCTGGCTGG + Intronic
1193679429 X:84500583-84500605 TTGCATTAGATTAATTTGGAAGG + Intronic
1194875276 X:99179385-99179407 ATGATTTGGCTTAGTGTGGAAGG - Intergenic
1198272453 X:135067382-135067404 CTGGATTAGGTTAATCAGGATGG - Intergenic
1198532913 X:137563294-137563316 AGTAACTAGCTTTATCTGGAGGG + Intergenic
1199842434 X:151663893-151663915 AGGCACTAGCTTAAGCTGGAGGG + Intronic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic
1201673088 Y:16547341-16547363 ATACATTGGTTTAATCTGGAAGG + Intergenic