ID: 951152878

View in Genome Browser
Species Human (GRCh38)
Location 3:19313187-19313209
Sequence CAAGGCAGGCACTCAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951152878 Original CRISPR CAAGGCAGGCACTCAAAAGG GGG Intronic
900079841 1:847710-847732 CAAGGCAGGCACTCAACGGTAGG - Intergenic
900951733 1:5861868-5861890 GAAGGCAGACACTCTAAAGCAGG + Intergenic
902362216 1:15948109-15948131 CAAAACAGGCCCCCAAAAGGTGG + Intronic
902894517 1:19469711-19469733 GAAGGAAGATACTCAAAAGGAGG + Intronic
903320770 1:22541863-22541885 CAAGGCATGGACTCTCAAGGGGG + Intergenic
903608169 1:24590232-24590254 CACGGCAAACACTCAAATGGTGG + Intronic
905338324 1:37260525-37260547 AACGGCAGGCACTCTAATGGAGG + Intergenic
905641400 1:39592463-39592485 CCAGGCAGGGACACAAGAGGAGG - Intergenic
905938931 1:41847644-41847666 TAGGGCAGGCACTAAAAAGGCGG + Intronic
906182730 1:43835807-43835829 CAAGGCAGGCAAGCAGATGGTGG + Intronic
906717400 1:47980303-47980325 CAAACCAGGTACTCACAAGGAGG + Intronic
907420190 1:54342009-54342031 GAAGGCAGGCTTTCAAAATGCGG + Intronic
908469042 1:64424021-64424043 CAAAGCAGGCACTTCAAAGGAGG - Intergenic
910210209 1:84784438-84784460 CAAGGCTGACATTCAAAAGAGGG + Intergenic
911194970 1:94985045-94985067 AAAGGCAGGCACACAGAAGTTGG + Intronic
913280703 1:117182456-117182478 CAAGCCAGGCCCTCAAGGGGTGG - Intronic
915269819 1:154746147-154746169 CAAGCCAGGCACACAGGAGGGGG - Intronic
918324091 1:183393032-183393054 CATAGTAGGCACTCAAATGGTGG + Intronic
918730202 1:187983901-187983923 CAAGTCAGGGAAACAAAAGGAGG + Intergenic
920320567 1:205118833-205118855 CACAGCAGGGACTCAAAAAGTGG + Intronic
922554668 1:226523712-226523734 CAAGGCTCCCACCCAAAAGGGGG + Intergenic
923761512 1:236849453-236849475 TAAGGTAGGCTCTGAAAAGGGGG + Intronic
924390963 1:243556499-243556521 CAAGGCAAGCAATTATAAGGAGG + Intronic
1063209437 10:3865584-3865606 CAAGGAAAGCTCTCAAAAGGAGG - Intergenic
1065693506 10:28358453-28358475 CAATGCAGGCACTAAAAGGGAGG - Intergenic
1069589727 10:69634337-69634359 CATGGCAGGCTCTCAGATGGAGG - Intergenic
1069614714 10:69799793-69799815 CAGGGCAGGCACTCAATAAAGGG - Intergenic
1072544097 10:96421097-96421119 CAAGTCAGGCACCTGAAAGGAGG + Intronic
1072781350 10:98253813-98253835 CATGGCAGTGACTCAAAGGGTGG + Intronic
1077968844 11:7166145-7166167 CCAGGGAGGCACGCAAGAGGAGG + Intergenic
1083719576 11:64597754-64597776 CATGGCAGGCGCTCAGCAGGCGG + Intronic
1084204112 11:67581535-67581557 AAAGGCAGGCACTCTCAGGGAGG - Intergenic
1085773135 11:79342374-79342396 GAAGGCAGGCTCTGAAAATGTGG + Intronic
1086001317 11:81988751-81988773 AAAGGCAGGCACTTCAAGGGAGG + Intergenic
1086850427 11:91801119-91801141 CAAGGCAGGAAATTAAAAGTTGG - Intergenic
1089299200 11:117488269-117488291 CAAGGCAGCCCCTTAATAGGGGG + Intronic
1089450083 11:118588294-118588316 CAAGGCAGGATCTCCAAAAGGGG - Intronic
1089745141 11:120611484-120611506 CAAGGAAGGCGCTCAAAAAATGG + Intronic
1089877730 11:121741887-121741909 CATAGCAGGCTTTCAAAAGGGGG - Intergenic
1090833076 11:130433052-130433074 CACAGCAAGCACTCAAAAGATGG - Intergenic
1090934782 11:131331750-131331772 CCAGGCAGGCACTTCACAGGAGG - Intergenic
1091968721 12:4767363-4767385 CATGGCAGGCACTCAACAAATGG + Intronic
1092622030 12:10282733-10282755 CAAGGAAGGCATTCCAAAGGAGG + Intergenic
1093421856 12:18982915-18982937 CAGGGAAGGCACTCACAAGAGGG + Intergenic
1094098129 12:26731198-26731220 CAAGGCAGGCATTCAACAAATGG + Intronic
1095796014 12:46219445-46219467 CTAGCCAGCCACACAAAAGGAGG + Intronic
1096791108 12:54045935-54045957 CAAGGTAGCCACTAAAAAGAAGG + Intronic
1098196787 12:68010710-68010732 CAAGGCAAGAACACAGAAGGAGG - Intergenic
1098392224 12:69981507-69981529 CAATGCATGAACTCAAAGGGAGG - Intergenic
1099856438 12:88173723-88173745 CATGGCAGGCATTCAAAAATGGG - Intronic
1100029395 12:90167707-90167729 CAAGGCAGGCATGCCTAAGGAGG + Intergenic
1101535702 12:105614291-105614313 CCAGGGAGGCACTCAGAAGGAGG + Intergenic
1105225282 13:18426063-18426085 CAAGGTAGGCACTACAAATGTGG + Intergenic
1106194737 13:27483571-27483593 CAAGCCAGGCACCCAAACGCAGG + Intergenic
1107718898 13:43227813-43227835 CAAGGCAGGCAGTCACAAATAGG + Intronic
1108713949 13:53060504-53060526 CAAAGCAGGCACTCAACATATGG + Intergenic
1110364929 13:74671970-74671992 CAAGAAAGCTACTCAAAAGGAGG + Intergenic
1111497235 13:89068223-89068245 AAAGGCAGACACTCAAACGATGG + Intergenic
1112417785 13:99217889-99217911 CCAGGCAGGCAGTGAAATGGGGG - Intronic
1114009750 14:18354407-18354429 CAAGGTAGGCACTAAAAATGTGG + Intergenic
1114405480 14:22452423-22452445 AATGGTAGGCACTCAAAAAGTGG - Intergenic
1114486946 14:23068475-23068497 CAAGACAGGGAGGCAAAAGGGGG + Intronic
1115775716 14:36712989-36713011 CAAGGAAGGCAGTCTAGAGGTGG + Intronic
1118325887 14:64780083-64780105 CAAAACAGGCACTCAGAAGAGGG - Intronic
1118671387 14:68131757-68131779 CATGGCAGTCAAACAAAAGGTGG - Intronic
1118708716 14:68502583-68502605 AAAGGTAGGCACTCATCAGGTGG - Intronic
1122115560 14:99525684-99525706 GGAGGCAGGCACTGAAGAGGGGG + Intronic
1122345984 14:101060575-101060597 CAAGTCAGGTACTCGAATGGAGG + Intergenic
1122629324 14:103100096-103100118 CAAGGAAGGCTCTCCAGAGGAGG - Intergenic
1122812117 14:104294224-104294246 CAAGGCAGGCTCTTCACAGGAGG - Intergenic
1124595574 15:31089013-31089035 CAAGTGAGGCACTCAAATGGGGG + Intronic
1125340496 15:38670860-38670882 CAAGGCAGGAAGTCCAGAGGTGG + Intergenic
1125955205 15:43786106-43786128 CAAGCAAGGCACTAAAAAGCTGG + Intronic
1125955539 15:43788431-43788453 CAAGCAAGGCACTAAAAAGCTGG - Intronic
1126926645 15:53595558-53595580 CAAGGTAGGCTCTCAAAATTAGG + Intronic
1127554149 15:60070952-60070974 CATGGGAGGCACACAAAATGTGG + Intergenic
1128124574 15:65183160-65183182 CAAGACAGACACACAAAAAGAGG + Intronic
1129233208 15:74208242-74208264 CAAGGGAGGCAATCAAGAAGAGG + Intronic
1129938809 15:79476095-79476117 CAAGGCAGGCTTTCAGGAGGAGG + Intergenic
1131873715 15:96783716-96783738 CAAGGCAGCCTCTGAAAAGAGGG - Exonic
1132668123 16:1091076-1091098 CAGGGCAGGCCCTAAAGAGGGGG + Intronic
1133578484 16:7118408-7118430 CAAGTCAGAGACTCAGAAGGAGG + Intronic
1133655036 16:7853135-7853157 CAAGGGAGGCTTTCAAGAGGTGG + Intergenic
1133913265 16:10085259-10085281 AGAGGCAGGCACTTCAAAGGAGG + Intronic
1134626651 16:15727143-15727165 CCAGGAAGGCACACAACAGGGGG + Intronic
1135987702 16:27196117-27196139 CAAGCCTGCCACTCAAAGGGAGG + Intergenic
1136107254 16:28038717-28038739 AAAGGCAGGCTCTCAGAAGCGGG - Intronic
1137918600 16:52461418-52461440 GAAGGCAGGAACAAAAAAGGGGG - Intronic
1138501691 16:57449282-57449304 TCAGGCAGGCACTTTAAAGGGGG + Intronic
1138701554 16:58868617-58868639 TGAGGAAGGCACTCATAAGGAGG - Intergenic
1141812554 16:86385223-86385245 CAAGGCAGGAAATCATAGGGAGG - Intergenic
1143212161 17:5196402-5196424 CAAGGCAGGATCTCCAAGGGAGG - Intergenic
1144507951 17:15849350-15849372 CAAGGCAGGAACTGGAGAGGAGG - Intergenic
1144949346 17:18985588-18985610 GAAGGCAGGCCCTCGACAGGGGG + Intronic
1145172075 17:20666982-20667004 CAAGGCAGGAACTGGAGAGGAGG - Intergenic
1146414037 17:32615248-32615270 CATGGCAGGCCTTCAAGAGGAGG + Intronic
1146837337 17:36122577-36122599 CAAGACTGGGACACAAAAGGAGG - Intergenic
1147054553 17:37824412-37824434 CAAGGAAGGCTTTGAAAAGGGGG - Intergenic
1147359872 17:39923836-39923858 CAGGGCAGGAACCCAGAAGGGGG + Intronic
1147444172 17:40464680-40464702 CAAGGAAGGTATTCAACAGGAGG - Intergenic
1147712394 17:42478497-42478519 CAAAGCATGCGCTCAAAAGTAGG - Exonic
1149315003 17:55430764-55430786 CCTGACAGGAACTCAAAAGGGGG - Intergenic
1153289852 18:3490154-3490176 CAAGGCAGGTGCTCAACATGCGG - Intergenic
1154528088 18:15313459-15313481 CAAGGTAGGCACTACAAATGTGG - Intergenic
1156529138 18:37798053-37798075 CATGGAAGACAGTCAAAAGGGGG + Intergenic
1157191597 18:45586668-45586690 AAGAGCAGGGACTCAAAAGGTGG - Intronic
1157290310 18:46405351-46405373 CAGGGCTGGCACTCGGAAGGGGG + Intronic
1158891364 18:61875152-61875174 GAAGGCAGGCATTCTAAATGAGG + Intronic
1160533147 18:79577126-79577148 CCAGGCAGGCCCTCACAAGAGGG - Intergenic
1163312368 19:16522084-16522106 CAGGGCAGGGCCTCAACAGGAGG - Intronic
1166895926 19:46021933-46021955 CAAGGCAGCCACTCTCAGGGAGG + Intronic
1167634419 19:50646139-50646161 CCAAGGAGGCACCCAAAAGGAGG - Intronic
1168726317 19:58584053-58584075 CAATGCAGCCACCCCAAAGGTGG - Intergenic
925332182 2:3067108-3067130 CATCGCAGGCACTGAAAAGATGG - Intergenic
925351996 2:3207583-3207605 CATGGCAGGCACTCAGAACAGGG + Intronic
927554948 2:24024743-24024765 CAAGACAGGGACACAGAAGGAGG - Intronic
928613420 2:33012658-33012680 CAATGCAGGCATTTAAGAGGGGG + Intronic
930189522 2:48443114-48443136 CACAGCAGGCACTCAAAAAAAGG - Intronic
931947296 2:67324545-67324567 CAAGGCAGGCAGTGGAAAAGGGG - Intergenic
932029415 2:68168099-68168121 AAAAGCAGGCACTCTGAAGGAGG + Intronic
933794970 2:85912346-85912368 AAAGGCTGGCACTGAGAAGGCGG - Intergenic
933891090 2:86770778-86770800 CATGGTAGGCACTCAAATTGTGG + Intronic
937478880 2:122239232-122239254 CACAGCTGGCACTCCAAAGGAGG + Intergenic
938527187 2:132144920-132144942 CAAGGTAGGCACTACAAATGTGG - Intergenic
939914471 2:148021651-148021673 CAGGGAAGGCACTCAAAAGTGGG + Exonic
940027134 2:149219967-149219989 CAAAGCAGGCACGAGAAAGGAGG + Intergenic
940674182 2:156708782-156708804 CCTGGCAGCCACTGAAAAGGTGG - Intergenic
942498724 2:176565867-176565889 GAAGCCAGGCAGCCAAAAGGAGG - Intergenic
943480677 2:188412845-188412867 CAAAGCAGGCACTAAAGAGTGGG - Intronic
946336287 2:219038777-219038799 CAGGGAAGGCACTCCAAAGAGGG + Intronic
946999854 2:225441594-225441616 CAAGGCACGATTTCAAAAGGCGG + Intronic
948264000 2:236624448-236624470 CAAGGAAGGCATTCAGGAGGAGG + Intergenic
948321821 2:237076037-237076059 CCAGGCAGGCAGGCAAGAGGTGG - Intergenic
948423286 2:237873468-237873490 CATAGCAGGCACCCCAAAGGTGG - Intronic
948681716 2:239639698-239639720 AAAAGCAGGCACTTCAAAGGAGG - Intergenic
1168836586 20:881685-881707 CAAGGCTGGCACAGAGAAGGTGG + Intronic
1169830568 20:9820722-9820744 CAAGGCAGGCACAACAAAAGTGG + Intronic
1175694575 20:61091906-61091928 GAAGGCAGGTACTGAAAAGGAGG + Intergenic
1176769339 21:13055082-13055104 CAAGGTAGGCACTACAAATGTGG + Intergenic
1180023633 21:45145723-45145745 CAAGACAGGCACACAGCAGGAGG + Intronic
1180040840 21:45278836-45278858 CAAGGAAGGCACTGAGGAGGAGG - Intronic
1180434250 22:15285216-15285238 CAAGGTAGGCACTAAAAATGTGG + Intergenic
1180516439 22:16149026-16149048 CAAGGTAGGCACTACAAATGTGG + Intergenic
1181419771 22:22789632-22789654 CCAGGCAGGCTCTGAAGAGGGGG + Intronic
1181770256 22:25120039-25120061 CACAGCAGGCACTCAAGAAGTGG - Intronic
1182301480 22:29339629-29339651 CAAGGCAGGGGCTCAGCAGGTGG + Intronic
1183335858 22:37245388-37245410 CAAGCCAGGAACTCCAAAGGAGG + Intergenic
1183696598 22:39427214-39427236 CAAGGGAGGCACTCAATCAGTGG - Intronic
1184408086 22:44311516-44311538 CAGGCCAGGGGCTCAAAAGGGGG - Intronic
951152878 3:19313187-19313209 CAAGGCAGGCACTCAAAAGGGGG + Intronic
951369402 3:21826643-21826665 CAGAGCAGGCACTCTAAGGGTGG + Intronic
954366276 3:50147860-50147882 GAAAGCAGCCCCTCAAAAGGAGG - Intergenic
954979997 3:54737300-54737322 CAAGGCAGAGACTAAAAAGGGGG + Intronic
957021210 3:75129318-75129340 CAGGGCAGACAGCCAAAAGGGGG + Intergenic
957040165 3:75330175-75330197 CAAGGCAGGCATCCAGAAGTAGG + Intergenic
959477283 3:106826385-106826407 CAAGACAGGCACTCAAAAGAGGG + Intergenic
959535254 3:107477429-107477451 CATAGCAGGCACTCAAGAGATGG + Intergenic
960246593 3:115406643-115406665 CAAGGCTGGCACTCATACTGAGG - Intergenic
961451745 3:127005306-127005328 CAAGGGAGGCGCTAAACAGGCGG - Intronic
962173438 3:133127323-133127345 CATGGCAGCCACTCCACAGGGGG - Intronic
963828780 3:149984701-149984723 AAAAGCAGGCACTAATAAGGTGG + Intronic
964414468 3:156432915-156432937 CCTGGAAGGCACTGAAAAGGAGG - Intronic
965319372 3:167233051-167233073 CAGGGAAGGGACTCAAAGGGAGG - Intergenic
966173539 3:177111085-177111107 CACGCCAGGCACACAACAGGAGG + Intronic
966768752 3:183485387-183485409 CCAGACAGCAACTCAAAAGGGGG - Intergenic
967222416 3:187258552-187258574 AGAGACAGGCACTTAAAAGGAGG - Intronic
969108418 4:4825787-4825809 CAAGGCAGGGATTCAAATGTTGG - Intergenic
969349961 4:6592703-6592725 CAAGGAAGGCACTTAACTGGGGG + Intronic
970499673 4:16664744-16664766 CAATGCAGGCACCTGAAAGGTGG - Intronic
971581686 4:28349235-28349257 AAAGGCAGCCACTTTAAAGGCGG - Intergenic
978094243 4:104756024-104756046 CAAGCCAGGCAGACAGAAGGAGG - Intergenic
978267941 4:106849654-106849676 CAAAGACGCCACTCAAAAGGCGG - Intergenic
979264313 4:118683703-118683725 ACAGGCAGGAAATCAAAAGGTGG - Intergenic
979993825 4:127407615-127407637 CAAGGCAGCCACTCCAAGAGCGG - Intergenic
981088783 4:140711130-140711152 CAAAGAAGCCCCTCAAAAGGCGG + Intronic
981253579 4:142633686-142633708 AAAGGCAGGAACTCAAAAAGAGG + Intronic
982338809 4:154271704-154271726 CAAGGCAGGCAATCCTAAGAGGG - Intronic
982495286 4:156083684-156083706 CATGGTAGGCAGTCAAAATGTGG + Intergenic
986262259 5:6158146-6158168 CAAGGCAGTTCCTCTAAAGGTGG + Intergenic
986284847 5:6351583-6351605 CAGGGCAGGCACTCACAGTGAGG + Intergenic
986519442 5:8598373-8598395 CAAGTTAGGCACTTAGAAGGAGG - Intergenic
990409209 5:55523859-55523881 CAATGAAGGCTCTCTAAAGGGGG - Intronic
990835527 5:60015036-60015058 AAAGTCAGCCATTCAAAAGGAGG - Intronic
993864283 5:93173701-93173723 CAAAGGAGGAACTCACAAGGAGG + Intergenic
994956562 5:106540698-106540720 CAGGGAAGGAACTCAAGAGGTGG - Intergenic
995482512 5:112607352-112607374 AAAAGCAGGCACTTCAAAGGAGG + Intergenic
996424893 5:123303940-123303962 AAAGGCAGGCACTTCAAGGGAGG + Intergenic
998463449 5:142325509-142325531 CCCCGCAGGCAGTCAAAAGGGGG + Intronic
998666554 5:144304861-144304883 TAAGGGAGGCAACCAAAAGGTGG - Intronic
1000360641 5:160443438-160443460 CAAGGCAGGCATTCACTACGGGG + Intergenic
1002452573 5:179327282-179327304 TAAGGCAGGGACTCAAAACAGGG + Intronic
1003090933 6:3102518-3102540 GAAGGCAGGAACTCAAAATATGG - Intronic
1003802035 6:9680950-9680972 TAAGGCAGGCACTCCTAGGGCGG + Intronic
1004025883 6:11818245-11818267 CGAGGCACGTTCTCAAAAGGGGG - Intergenic
1006019765 6:31111256-31111278 CAGGGGAGGCACTGAAAAGTGGG + Exonic
1006468198 6:34208841-34208863 CAAGGCAGGCAGTCCAGAGCTGG + Intergenic
1007003568 6:38337714-38337736 GAAGACAGGCACTGTAAAGGGGG - Intronic
1012607819 6:101180057-101180079 GAATGCAGGCTCTCAAAAGAAGG - Intergenic
1014195591 6:118554784-118554806 CATGGCAGACAATCAAAAGGTGG + Intronic
1019256630 7:56600-56622 CCTGGCAGGAACTCAGAAGGGGG + Intergenic
1019595727 7:1857531-1857553 CAGGGCAGAAACTCAAAAGATGG - Intronic
1021945743 7:25725392-25725414 CAGAGCAGACAATCAAAAGGTGG + Intergenic
1022168833 7:27802348-27802370 CAGGGAAGGTACCCAAAAGGAGG - Intronic
1023705172 7:42933245-42933267 TCAGGCAGGCACTTTAAAGGGGG + Intronic
1023742949 7:43296971-43296993 GCAGGCAAGCACTCAGAAGGAGG - Intronic
1024033334 7:45483825-45483847 CTAGGCGGGCACTCTAAAGATGG - Intergenic
1024673525 7:51617795-51617817 CAAGGCAGGGACTCAGAGGCAGG - Intergenic
1025761660 7:64401499-64401521 CTAGGCAGGCCCTAAGAAGGAGG - Intergenic
1027692946 7:81370867-81370889 ACAGGCAGGCATTCAAAAGGAGG + Intergenic
1030141289 7:106306627-106306649 CAAGGCAGGCAGCCAATACGAGG - Intergenic
1030380298 7:108803481-108803503 CAAGGGAGGCACCCAACGGGAGG + Intergenic
1033476390 7:141697232-141697254 CACAGCAGGCACTCAGGAGGTGG + Intronic
1034817262 7:154183224-154183246 AAAGTCATGCACTGAAAAGGTGG - Intronic
1035525663 8:311207-311229 CAAGGCAGGCACTCAACCGTAGG + Intergenic
1035895612 8:3397173-3397195 CAAGTCAGGCACTCAGAAACCGG - Intronic
1036512404 8:9412915-9412937 CAAGGCAGCCCATCATAAGGTGG + Intergenic
1037181277 8:16008353-16008375 CATGGCAAGCATTCTAAAGGTGG + Intergenic
1037196601 8:16198489-16198511 CTAGGCAGGAACCCAAAAGGGGG - Intronic
1038092621 8:24270837-24270859 AAAGGCAGGCACTCTGAAGCAGG + Intergenic
1039494379 8:37969563-37969585 CAAGGCAGTCACTCCCAAGTAGG + Intergenic
1039920728 8:41892464-41892486 GGAGCCAGGCACTCACAAGGAGG - Intronic
1043158881 8:76820936-76820958 CAAGACAGGGACTAAAAAAGAGG - Intronic
1043478216 8:80625981-80626003 CAACGCATGCAATCAAGAGGGGG - Intergenic
1043514786 8:80986036-80986058 CATGGCAGGCACTCACAACACGG - Intronic
1047355913 8:124121381-124121403 TAAGGCAGGGACTTAAAATGAGG + Intergenic
1047669231 8:127126427-127126449 CAGGGCAGGCACAGCAAAGGAGG + Intergenic
1048728961 8:137416429-137416451 GAAGGAAGGAACACAAAAGGTGG + Intergenic
1049211502 8:141388559-141388581 GAAGGCAGGCACTGAGGAGGAGG + Intergenic
1049222272 8:141433554-141433576 CTGGGCAGGCACTCAAATTGAGG - Intergenic
1050366775 9:4880101-4880123 CAAGGCAGGCACCCCACAGCTGG - Intronic
1050720024 9:8577620-8577642 CAGGGGAGGCTTTCAAAAGGAGG - Intronic
1052805437 9:33009325-33009347 CAAGGCTGGGACTAAAGAGGTGG - Intronic
1053705879 9:40752253-40752275 CAAGGTAGGCACTACAAATGTGG - Intergenic
1054415956 9:64875857-64875879 CAAGGTAGGCACTACAAATGTGG - Intergenic
1055792935 9:79943063-79943085 CAAAGCAGGAACCAAAAAGGAGG + Intergenic
1056246520 9:84700938-84700960 CAAGGTAGGTACTCAAAGGATGG - Intronic
1056806299 9:89731681-89731703 GAAAGCAGCCACGCAAAAGGTGG - Intergenic
1056818282 9:89817497-89817519 CATGGCAGGCACACAGGAGGTGG + Intergenic
1060171387 9:121464189-121464211 CAAGCAAGGCATTGAAAAGGTGG - Intergenic
1060578216 9:124718297-124718319 CAAGCCTGACACTGAAAAGGAGG + Intronic
1060737263 9:126073951-126073973 TAAGGCAAGCTCTCCAAAGGGGG + Intergenic
1060753971 9:126196612-126196634 CAAGGCAGACATTTAAAAGCTGG - Intergenic
1187153799 X:16705643-16705665 AGAGGCAGGCACTCTGAAGGAGG - Intronic
1187558706 X:20378627-20378649 CAGGGCAGCCAATCATAAGGTGG + Intergenic
1192721481 X:73703026-73703048 CAAGGCAGGCATTCAAATTCAGG + Intergenic
1193379823 X:80805991-80806013 CAATGCAGCCACTCAAAATCAGG + Intronic
1193851227 X:86539247-86539269 CAAGGCACGTATTCACAAGGTGG - Intronic
1199729303 X:150615293-150615315 GAAGGCTGGGACCCAAAAGGTGG + Intronic