ID: 951154137

View in Genome Browser
Species Human (GRCh38)
Location 3:19328408-19328430
Sequence AAAGACCCCCAAATTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951154137 Original CRISPR AAAGACCCCCAAATTCATCA TGG (reversed) Intronic
901310143 1:8263040-8263062 AAAGCCCACAAAATACATCAAGG - Intergenic
905178834 1:36154740-36154762 AAAGACCCCAAGATACCTCATGG + Intronic
905763128 1:40577339-40577361 AAACTCCCCCAAATTCTTAACGG - Intergenic
906576327 1:46893808-46893830 AAAGACAGCCCAATTAATCACGG + Intergenic
906595594 1:47073779-47073801 AAAGACAGCCCAATTAATCACGG - Intronic
906732120 1:48091834-48091856 GAAGACCTCCATGTTCATCAGGG + Intergenic
907183841 1:52593987-52594009 AAAGAGCTACAAATTCCTCAAGG + Intergenic
907656708 1:56350525-56350547 AAAAATCCCCAAATTATTCAAGG - Intergenic
909110737 1:71473797-71473819 AAAGAGCTCCAAATTCCTAATGG + Intronic
909966660 1:81920635-81920657 AAAGCCCAGCAAATTCCTCAGGG - Intronic
910882625 1:91936230-91936252 AAAGACCACCAAATTCAAGAGGG - Intergenic
912881818 1:113423564-113423586 AAAAACCCCCAGACTCAGCAGGG - Intronic
915705335 1:157838362-157838384 AATGACCCCCAAATTATTTACGG - Intronic
915745398 1:158152747-158152769 AAAGACCCCTTAACCCATCATGG - Intergenic
915799791 1:158778196-158778218 AAAGAACACAAAATTCAGCAAGG + Intergenic
918176327 1:182048874-182048896 AAAGTCCCCCACACTCATCTCGG - Intergenic
923284672 1:232481917-232481939 AAAGTCCCCCAAATTCTAGAAGG + Intronic
1066116752 10:32247474-32247496 AAAGACCCCCGAAGTCATAAAGG + Intergenic
1069866040 10:71503443-71503465 ACAGCCCCCCAAAGTCATGAAGG - Intronic
1069977904 10:72230509-72230531 AAAAATCCCCAAACTCAGCAAGG + Intronic
1071014040 10:80973606-80973628 AAAAACCCCCAAAATTATAAGGG + Intergenic
1071947071 10:90657611-90657633 ACAGAACACCAAATTCATGATGG + Intergenic
1074561525 10:114539566-114539588 AAGGACTCCCAAATTTATAAGGG - Intronic
1075454799 10:122578238-122578260 AAAAACCCCCAGATTCTGCAGGG + Intronic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1078817453 11:14840367-14840389 AGAGGGCCCCAAATTCATTATGG - Intronic
1078855701 11:15204980-15205002 AAAGTCCCCCAAACCCAGCAAGG - Intronic
1079296199 11:19236752-19236774 AAGGTACCCCAAATTCACCACGG + Intronic
1080792121 11:35530751-35530773 AAAGATCCCCATATGGATCAAGG + Intergenic
1080907423 11:36560688-36560710 AAAGACCCCCACAGTCCCCACGG - Intronic
1085182285 11:74545950-74545972 AAAAAAACCCTAATTCATCACGG - Intronic
1085366010 11:75945525-75945547 ACAGACCCACAAATTCATTTTGG - Intronic
1085462592 11:76703196-76703218 AAATACCCCCAAACTCAATAGGG - Intergenic
1089131693 11:116217447-116217469 AAAGACCCCAAAATGTATTATGG + Intergenic
1090621792 11:128567108-128567130 AAAGAGCTCCAAATTAACCACGG - Intronic
1091435349 12:468345-468367 AAAGACCCCCAAAAAGGTCAGGG - Intronic
1091575245 12:1727782-1727804 AAAGACCCCCAACATCTTCGGGG + Intronic
1093275502 12:17120275-17120297 AAAGACAACAAAATTCAACAGGG + Intergenic
1093851378 12:24043587-24043609 AGGGTCCCCCAAGTTCATCATGG + Intergenic
1096869237 12:54583156-54583178 AAAAACCCCCACATTCATTAGGG - Intronic
1099481627 12:83174066-83174088 AAAAATCTCCAAATTCATCTGGG - Intergenic
1100000021 12:89822557-89822579 AGAAACCCCCATATTCATTAAGG + Intergenic
1100922001 12:99498742-99498764 AGAGACCCTCAAATTGATCTTGG - Intronic
1102450772 12:113040511-113040533 AATGTCCTCCAAGTTCATCAAGG + Intergenic
1102545584 12:113652699-113652721 AAAGACTCCCAAGGTCCTCAGGG + Intergenic
1105970908 13:25428681-25428703 ACAGACCCCCAAATATATAATGG + Intronic
1106302754 13:28484463-28484485 AAGGAGCCCCAAAGCCATCAAGG - Intronic
1109170160 13:59085240-59085262 AAAGAACCCTAAGTTCTTCAAGG + Intergenic
1110437538 13:75492261-75492283 AAAGCCCCCCAGATTCTTAAAGG + Intergenic
1110535633 13:76647710-76647732 AAAGGCTCCCAAATTCTTCAGGG + Intergenic
1112164332 13:96901698-96901720 AAAGAGACCCAAATTCATAGGGG + Intergenic
1114580239 14:23750836-23750858 CAAGACCACCAAATTGTTCAAGG + Intergenic
1114973297 14:28061572-28061594 AATAACCCCCAAGTTCCTCATGG - Intergenic
1115584309 14:34794788-34794810 AAAGTTCCCCAAATGCATTAAGG + Exonic
1115743136 14:36409267-36409289 AAACACCCCCAAATGAACCATGG - Intergenic
1118388842 14:65279894-65279916 GAAGACCATCACATTCATCAAGG + Intergenic
1121186168 14:91971651-91971673 ACAGATTCCCAAATTCATTATGG - Intronic
1122538475 14:102482764-102482786 AAAGACCCTCAAAATCCTAAAGG - Intronic
1125464606 15:39938350-39938372 AAGGACCCACACATTTATCAAGG + Intronic
1127075015 15:55317294-55317316 AAAAACCCACAAATACCTCATGG - Exonic
1128412556 15:67414097-67414119 AAAGAACCACAAATTCTTCCTGG - Intronic
1129123757 15:73420383-73420405 AAAGACCCAAAATGTCATCATGG - Intergenic
1132853508 16:2034966-2034988 CAAGACCCCCAAAATCTCCAGGG - Intronic
1134314896 16:13109513-13109535 AAAAACCCCCAACTTTATGATGG + Intronic
1137487948 16:48907295-48907317 AGAAAACGCCAAATTCATCAGGG - Intergenic
1138443680 16:57050155-57050177 CCAGACCCCCAAATACACCATGG - Intronic
1138704438 16:58899885-58899907 AGAGGCCCCAAAATTCATAATGG + Intergenic
1141277863 16:82604454-82604476 AAAGACCGTCAAATTGACCATGG - Intergenic
1141456930 16:84148935-84148957 AAATACCCCCAACTTCAGCTTGG - Intronic
1143663459 17:8341698-8341720 AAAGAACTCCAAATTCCTGAGGG - Intronic
1144372377 17:14604213-14604235 AATGACCCCCTCTTTCATCAGGG - Intergenic
1148231881 17:45941319-45941341 AAAGACCATCAAAATCATCAAGG - Intronic
1150315996 17:64169451-64169473 AGACACACCCAGATTCATCAAGG + Intronic
1150658778 17:67057762-67057784 AAAAACCCCCAAAACAATCAAGG + Intergenic
1151379127 17:73712808-73712830 AAAGACCCCCACACTCAGAAAGG + Intergenic
1154148392 18:11885675-11885697 AAACAACCCCAGTTTCATCATGG - Exonic
1155509036 18:26558989-26559011 AATGACCCCCAGTTCCATCAAGG - Intronic
1158148246 18:54340966-54340988 ATAGAGCCCCAAATACATAAAGG + Intronic
1159240145 18:65731897-65731919 CAACCCCCTCAAATTCATCATGG - Intergenic
1160561500 18:79760694-79760716 AAACAACCCCAAATTCAGCAAGG - Intergenic
1161141769 19:2652322-2652344 AAAGAACCCCAAATACAGCCAGG + Intronic
1165428934 19:35760924-35760946 AAAGAGTCCCAAATTAATTATGG + Intronic
1168031563 19:53683681-53683703 AGTGACACCCAAATTCATGATGG - Intergenic
1168037085 19:53728427-53728449 AGTGACACCCAAATTCACCATGG - Intergenic
925962055 2:9026973-9026995 AAAGGACCCCAAATTCAAAAAGG - Intergenic
926544806 2:14226312-14226334 AATGACCCCCAAAGTTATCCAGG - Intergenic
928276146 2:29901912-29901934 ACAGAACACAAAATTCATCAGGG + Intronic
929003926 2:37377127-37377149 AAAAACCCCTAAATTCACAAAGG + Intergenic
929706694 2:44220283-44220305 AAGGACCCCAAAATCCAGCAAGG - Intronic
931962517 2:67497982-67498004 AGAGACCCCCAAATTCAGGTTGG - Intergenic
933203522 2:79478534-79478556 AATGACCCCCAACCTAATCATGG - Intronic
939906235 2:147919422-147919444 AAGGACCCCCAAAGTTATTAAGG + Intronic
943396465 2:187341657-187341679 AAAGACAACCAAATTAATAATGG + Intergenic
943825902 2:192391630-192391652 AAAAACCCACTAATTCAACAGGG - Intergenic
944047441 2:195429132-195429154 AAAGACCCCAAACTTTATGATGG - Intergenic
944566023 2:200991891-200991913 AAAAACCCCCAAAATCCTAATGG + Intronic
945538103 2:211045661-211045683 AAAAATCCCCAAATTCATCATGG + Intergenic
947482590 2:230514843-230514865 GAAGTCCCCCAAATACCTCAAGG + Intronic
947683147 2:232054500-232054522 AGAGACCTCTAAATTCATTAGGG + Intronic
1169669023 20:8074463-8074485 AAAACCAACCAAATTCATCAGGG + Intergenic
1173445423 20:43113222-43113244 AAAGACAGCAAAGTTCATCATGG - Intronic
1174451090 20:50620959-50620981 ACAGGCCCTCAAGTTCATCAAGG + Intronic
1175410642 20:58765765-58765787 AATGAACACCAGATTCATCAGGG + Intergenic
1176117335 20:63438803-63438825 ACACCCCCCCCAATTCATCAGGG + Intronic
1176117346 20:63438848-63438870 ACACACCCCCCAATTCATCAGGG + Intronic
1176117359 20:63438893-63438915 ACACACCCCCCAGTTCATCAGGG + Intronic
1177308585 21:19354933-19354955 AATGACTCTCAAATTCAACAAGG - Intergenic
1177825107 21:26074206-26074228 AATGCCCCCCAAATTTTTCATGG + Intronic
1179073780 21:38098761-38098783 AAAGATCCCCATAGTCAACAAGG - Intronic
1182529586 22:30944975-30944997 AAAGCCCCACACATTCATCAAGG + Intronic
949243756 3:1901147-1901169 AGAAACCCCCAAAGTCATTATGG - Intergenic
949276256 3:2286073-2286095 AAAGCCACCCAAAGTCAGCAAGG - Intronic
950437319 3:12987832-12987854 AAAGATCCCCAACCTCATCGGGG + Intronic
951154137 3:19328408-19328430 AAAGACCCCCAAATTCATCATGG - Intronic
951818437 3:26781912-26781934 ATATTCCCCCAAATTAATCATGG - Intergenic
953579640 3:44142166-44142188 AATGCCCCCCAAAGTGATCAAGG + Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
958848592 3:99294454-99294476 AAAGAAGCCCAAAGTCATCAGGG + Intergenic
960292639 3:115905004-115905026 AAAGACTCACAAATTCTTCAAGG - Intronic
961379299 3:126486915-126486937 AAAGTGCCACAAATTCATCCTGG - Intronic
963013309 3:140796556-140796578 AATGATCCCCAATTTCATCCAGG + Intergenic
965366918 3:167812458-167812480 TAATATCCCCAATTTCATCAAGG + Intronic
970212965 4:13730203-13730225 GGAGACCCCCAGATTCAGCACGG - Intergenic
971234799 4:24831126-24831148 AAAGACCCTCAAAGTCATGCTGG + Intronic
972258695 4:37386319-37386341 AAAGACCTATAAATTCATGATGG - Intronic
972920541 4:43935712-43935734 AAAATCCTCCAAGTTCATCATGG + Intergenic
973261183 4:48165486-48165508 AATGAACCCCCAAATCATCAGGG + Intronic
973875349 4:55212663-55212685 GAAGAGCTCCTAATTCATCAGGG - Intergenic
978369236 4:108013892-108013914 AAAGGCATCCAAAATCATCATGG - Intronic
980745982 4:137016510-137016532 AAAGATTCTAAAATTCATCAGGG - Intergenic
983609112 4:169623343-169623365 AAAAAAACCCAAATTCCTCAGGG - Intronic
984125820 4:175809016-175809038 AAAGCCCTCCTAATTCAGCAAGG + Intronic
985622159 5:961389-961411 AATGACCCCCAAACTCAACGGGG + Intergenic
991471842 5:66977073-66977095 AAGGATCCCCATATTCATGAAGG - Intronic
992981447 5:82178148-82178170 ACAGACTCCCATATTCATAAAGG - Intronic
993999655 5:94763966-94763988 AAAGACCCCCAAAATCATAGAGG + Intronic
994138319 5:96314303-96314325 AAAGATGCCCAACTTCAGCAAGG - Intergenic
995415689 5:111910490-111910512 AAAGACCCACATATTTATAATGG + Intronic
995927616 5:117394328-117394350 AAGGACTCCCAAAGTTATCAGGG - Intergenic
998517731 5:142770851-142770873 CAAGACCAACAAATTCATCAAGG + Exonic
1004448367 6:15723563-15723585 GAAGACCCCCAAATTTAGCATGG + Intergenic
1004915169 6:20325141-20325163 AAAGATCCGCAAATTCAGCAGGG - Intergenic
1006783911 6:36651950-36651972 GAAGACCTCCACATTCCTCAGGG - Intergenic
1006845606 6:37059425-37059447 GAACACCCCCAAAGTCATCCAGG - Intergenic
1008886134 6:56432897-56432919 AGAGGCCCCCAGATTCATCGAGG - Intergenic
1009884415 6:69607729-69607751 AAAGACCCCCAAAGTTAGAAAGG + Intergenic
1011184964 6:84663958-84663980 TAAGACAGCCAAATTCATGAGGG + Intergenic
1015176554 6:130315866-130315888 AAAGTCCCCCAAGTCCATCAGGG - Intronic
1016339029 6:143041261-143041283 CAAGACCCCAAGATTCTTCAAGG + Intergenic
1019419033 7:942134-942156 AATTATCCCCAAATGCATCATGG + Intronic
1020131017 7:5558700-5558722 AAAGACTCCCAAATACAGCAAGG + Intronic
1020618537 7:10490657-10490679 AAAGACTCCCAAATGTATCTGGG + Intergenic
1026485982 7:70821821-70821843 TAACACCCCCAAATACATCAAGG + Intergenic
1027931012 7:84535130-84535152 AAAGACTCCCAGATACATCTTGG - Intergenic
1028354945 7:89895688-89895710 AAAGGCTCCCAAACTCCTCAGGG + Intergenic
1029011673 7:97268638-97268660 AAAGACCACCAAATTCAATGTGG - Intergenic
1029422021 7:100476807-100476829 AAAGACCCCCACATTCAGGATGG + Intronic
1031154450 7:118093525-118093547 TAAAACCCCCAAATTTATCAAGG + Intergenic
1032999311 7:137485537-137485559 GAACACACCCAAATTCATAAAGG + Intronic
1033612453 7:142977492-142977514 AAATAACCCCAAATAGATCATGG + Intergenic
1034693564 7:153034209-153034231 AAATATACACAAATTCATCATGG + Intergenic
1035329958 7:158089682-158089704 GAAGACCCCCTCTTTCATCAGGG - Intronic
1035330035 7:158090071-158090093 GAAGACCCCCTCTTTCATCAGGG - Intronic
1036460057 8:8944342-8944364 AAGGTACCCCAAATTCATTAAGG - Intergenic
1036582447 8:10088040-10088062 AAAGTCCCCCAGATGCTTCAGGG - Intronic
1038661563 8:29501895-29501917 GAAGACCCCCAAAGTCAGCAAGG + Intergenic
1044309322 8:90675408-90675430 AAAGATCCCCAAATACACAATGG - Intronic
1046291772 8:112171754-112171776 TAAGATCCCAAAATTCATCTAGG - Intergenic
1046731696 8:117733013-117733035 AAATACTCTAAAATTCATCATGG - Intergenic
1047351234 8:124076516-124076538 AAGTACCACCAAATTCCTCAGGG - Intronic
1050719304 9:8567193-8567215 AGGTACCGCCAAATTCATCATGG - Intronic
1051225108 9:14890988-14891010 AAAAACACTCACATTCATCATGG + Intronic
1052032071 9:23640059-23640081 TAAGACCCCAAATTTCATCACGG - Intergenic
1053829685 9:42064742-42064764 AATGGCCCCCAACTGCATCATGG + Intronic
1054600874 9:67122712-67122734 AATGGCCCCCAACTGCATCATGG - Intergenic
1055392169 9:75834642-75834664 AAAGGCCTCCAAATTTTTCATGG - Intergenic
1055693637 9:78859665-78859687 AAATACCTCCTCATTCATCAGGG - Intergenic
1058024674 9:100128743-100128765 AAAGATCACCAAACTCATAAGGG + Intronic
1058431351 9:104923130-104923152 AAAGGTCCACAACTTCATCAAGG + Intronic
1058870320 9:109195826-109195848 AAAAGACTCCAAATTCATCATGG + Intronic
1059193796 9:112351812-112351834 AAAAACCCCCACATTGATGAGGG - Intergenic
1059562616 9:115349760-115349782 AAACAAGCCCAAATTTATCAGGG - Intronic
1059640424 9:116211562-116211584 AAGAACCCCCAAGTCCATCAAGG - Intronic
1059944845 9:119399127-119399149 AAAAACCCAAAAATTCCTCAAGG + Intergenic
1186013440 X:5164088-5164110 AAAGACACACAAATTTATTATGG - Intergenic
1187157488 X:16734450-16734472 AAATTCCCCCAGATTTATCATGG + Intronic
1188529786 X:31127197-31127219 AAATGCCTCCAATTTCATCATGG - Intronic
1188598465 X:31930464-31930486 CAAGACCTCCAAAATCACCATGG + Intronic
1189317871 X:40068567-40068589 ACAGACACCCAAATTCAAGAAGG + Intronic
1194269676 X:91795834-91795856 TAAGACCCCAAAATACATTAAGG + Intronic
1197886925 X:131227992-131228014 AAAAAATCCCAAATTCATTATGG - Intergenic
1198015564 X:132606784-132606806 ACAGTTCCGCAAATTCATCATGG - Intergenic
1198682913 X:139202266-139202288 AAATACTCCCAGATTCAACAGGG + Intronic
1200586897 Y:5016815-5016837 TAAGACCCCAAAATACATTAAGG + Intronic