ID: 951165997

View in Genome Browser
Species Human (GRCh38)
Location 3:19485771-19485793
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 5, 1: 8, 2: 5, 3: 36, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900169776 1:1261214-1261236 CCAGTGAGGGGGAGGTCCGCGGG + Intronic
900254533 1:1691147-1691169 TCACTCAGGTGGACGCTGGCTGG + Exonic
900263284 1:1744422-1744444 TCACTCAGGTGGACGCTGGCTGG + Intronic
900351237 1:2235658-2235680 CCCCAGAGCTGGAGGCTCCCTGG - Intronic
900364321 1:2304698-2304720 CCACTGAGGTGGAGGCAGAGAGG - Intronic
901769212 1:11521944-11521966 GCACTGGGGTGGAAGCTAGCTGG + Intronic
902986641 1:20158567-20158589 CAATCGAGGTGGAAGCTCGCTGG - Intergenic
904371594 1:30051069-30051091 CCACTGTGCTGCAGGCTCACTGG - Intergenic
904721834 1:32516018-32516040 CCCATGAGGTGGAGGCTCCTGGG + Intronic
907799805 1:57753292-57753314 CCACTGAAGTCGAGGGTAGCAGG - Intronic
908539899 1:65112330-65112352 CCCCTGAGGTGGGGCCTGGCAGG - Intergenic
908569833 1:65397712-65397734 CCACTGAGGTGGAAGTTAGACGG - Intronic
909468336 1:75999741-75999763 CCACAGAGGTGTAGGCACACAGG - Intergenic
910725676 1:90336245-90336267 CCACTGCTATGGAGGCTCCCTGG + Intergenic
915044762 1:153003091-153003113 TTCCTGAGGTGGAGGCTGGCTGG - Exonic
918647178 1:186918233-186918255 CCACTGAGGTGGAGGCTCGCTGG + Intronic
919789652 1:201283070-201283092 CCCCGGCGGTGGAGGCTCCCGGG - Intergenic
920963493 1:210683829-210683851 CCCCGGAGGTGGAGGCTGCCTGG + Exonic
1064397212 10:14991555-14991577 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
1064400107 10:15014025-15014047 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1065322895 10:24525257-24525279 CCACTGAGGTGAAGGCAGCCTGG + Intronic
1066390411 10:34973604-34973626 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
1067089334 10:43258647-43258669 CTACTGAGCTGCAGGCTTGCTGG + Intronic
1067475823 10:46565337-46565359 TCACTGAGGTCAAGGCTCCCGGG - Intergenic
1067618916 10:47776438-47776460 TCACTGAGGTCAAGGCTCCCGGG + Intergenic
1070387859 10:75942073-75942095 CCAGTGGGATGGAGGCTCTCTGG + Intronic
1071282234 10:84113319-84113341 CCACTGAGGTGGAGGCTCCCTGG - Intergenic
1072195790 10:93116296-93116318 CCTCTGAGGAAGAGGCTGGCAGG - Intergenic
1072275323 10:93816974-93816996 CTGCCGAGGTGGAGGCTCACGGG - Intergenic
1073998797 10:109346292-109346314 CCACTGGGGTGGAAGCTCTCTGG - Intergenic
1076395805 10:130136665-130136687 CCACTCACGCGGAGGCTCGGGGG - Intronic
1076563228 10:131381127-131381149 CCAGTGAGATGGAGGCTGGAGGG + Intergenic
1077773666 11:5248410-5248432 CCCCTGAGGTGCAGGCTTCCTGG - Exonic
1077774176 11:5253328-5253350 CCCCTGAGGTGCAGGCTTCCTGG - Exonic
1082035429 11:47642067-47642089 TCACTGAGGTGGATCCTGGCCGG - Intronic
1082271662 11:50178821-50178843 CAACTGAAGTGAAGGCTAGCTGG - Intergenic
1084128212 11:67115118-67115140 AGACTGAGGTGGAGGATTGCTGG - Intergenic
1084227699 11:67727534-67727556 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
1084244718 11:67849031-67849053 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1084261105 11:67979221-67979243 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1084472451 11:69371049-69371071 CCACTGTGGTGGAGACCCACCGG - Intergenic
1084488269 11:69463744-69463766 CCACTGAACTGGAGGCAGGCTGG - Intergenic
1084811547 11:71614874-71614896 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
1084827966 11:71745525-71745547 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
1084844623 11:71889337-71889359 CCAGCCAGGTGGAAGCTCGCTGG - Intronic
1085756848 11:79208968-79208990 CCACTGAGGTAGTGGCCCGAGGG - Intronic
1091897743 12:4118773-4118795 CCACTGAGGTGGGAGCTAACTGG - Intergenic
1092415282 12:8286176-8286198 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1092510855 12:9154693-9154715 CCCCTGAGGTGGGGGCTGGCTGG + Exonic
1093289313 12:17301729-17301751 CAACTGAGGTAGAAGCTCACTGG - Intergenic
1095477033 12:42596137-42596159 GCAGTGAGGTGGAGGCTTGGAGG + Intergenic
1097179886 12:57165814-57165836 GCACTGGGGTGGAGGCACGTAGG - Exonic
1098216888 12:68230148-68230170 ACACACAGGTGGAGGCTCTCAGG - Intergenic
1098748655 12:74269177-74269199 CCACTGAGGTGGAGGCTCGCTGG - Intergenic
1100455803 12:94750532-94750554 CCACTGAAGTGGAGGGTCCAGGG + Intergenic
1101029240 12:100643756-100643778 CCACTGAGGTGGAGGCTCACTGG + Intergenic
1101750879 12:107581417-107581439 GCGCTGGGGTGGAGGCTCCCTGG + Intronic
1102107146 12:110335240-110335262 CTACTGAGGTCTAGGCTCCCCGG - Intronic
1102168905 12:110827237-110827259 ACAGTGAGGAGGAGGCTTGCTGG + Intergenic
1105728081 13:23185679-23185701 CCACAGAGCTGGAGGCCTGCAGG + Intronic
1105919014 13:24943273-24943295 CCACTCAGCTGGAGGCCTGCTGG + Intergenic
1107483879 13:40808128-40808150 CCACTCAGCTGGAGGCCTGCTGG + Intronic
1107490492 13:40876512-40876534 CAACTGAGGTGGAAGCTCGCTGG + Intergenic
1107851420 13:44576580-44576602 ACACTGAGCTCGGGGCTCGCTGG - Intronic
1109340142 13:61046580-61046602 CCAGTGTGGTGGAAGCTAGCAGG - Intergenic
1109803013 13:67402042-67402064 CCACTGAGGTGGAGGCTTGCTGG - Intergenic
1113597828 13:111547130-111547152 CGACTCAGGTGGAGGCTGGAGGG - Intergenic
1117038807 14:51751796-51751818 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
1117260091 14:54023210-54023232 CCACAGAGGTGTATGCTCACAGG + Intergenic
1123029193 14:105443093-105443115 CCACTGCGGTGGAGCCTGTCAGG + Intronic
1123704763 15:22943119-22943141 CCACTGAGCTGGGTGCTCTCGGG + Intronic
1125732303 15:41899991-41900013 GCACTGGGATGGAGGCACGCTGG + Exonic
1127096293 15:55514976-55514998 CCACTGAAGTGGAGGTTCGCTGG + Intergenic
1128549689 15:68590276-68590298 CCACTGAGTTTGTGGCTCCCAGG - Intronic
1129263240 15:74380748-74380770 GCCCTGATGTGGAGGCTCCCTGG + Intergenic
1129313507 15:74727737-74727759 CCACTGTGGTGGGGGGTGGCGGG - Intergenic
1129391809 15:75224488-75224510 CCACTGAGGTGGGGGCACTCAGG - Intergenic
1132574875 16:659701-659723 TCACGGAGGAGGAGGCTGGCAGG + Intronic
1132601243 16:774145-774167 CCGGTGAGGTGCAGGGTCGCAGG + Intronic
1140778356 16:78271620-78271642 CCAGTGAGGTGGAGCCTCTGAGG + Intronic
1141445400 16:84054849-84054871 CCTGTGGGGTGGAGGCTCGGTGG + Intronic
1142140866 16:88472148-88472170 ACACTGAGGCTGGGGCTCGCTGG - Intronic
1143333444 17:6155218-6155240 CCACGGAGGAGGCGGCTTGCAGG + Intergenic
1143541322 17:7571157-7571179 ACACTGAGTTGGAGGTTAGCAGG - Intronic
1145864836 17:28234383-28234405 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1146458148 17:33023107-33023129 CCAGTTAGGTGGAGGCTGGGAGG + Intronic
1148132496 17:45270537-45270559 CCTCACAGGCGGAGGCTCGCTGG + Exonic
1148155017 17:45418730-45418752 TGTCTGAGGTGGAGGCTCCCAGG + Intronic
1149076137 17:52597631-52597653 CAATGGAGGTGGAAGCTCGCTGG - Intergenic
1149445652 17:56711311-56711333 CCACTAAGGTGCAGTCTAGCTGG + Intergenic
1149566807 17:57645964-57645986 CCACTGGGGTGGAGGATCGTGGG + Intronic
1149636720 17:58176971-58176993 CCACTGAGGTGAAGGCTGAGGGG + Intergenic
1150386720 17:64767466-64767488 TGTCTGAGGTGGAGGCTCCCAGG + Intergenic
1150776262 17:68084075-68084097 CCCAGGAGGTGGAGGCTTGCAGG - Intergenic
1152177417 17:78797120-78797142 TCACTGAGGTGGAGGCTTTGGGG - Exonic
1152565234 17:81097411-81097433 CCCCTGTAGTGGAGGCTTGCGGG + Intronic
1152617200 17:81343450-81343472 CCACTGAGGAGGAAGGTTGCCGG - Intergenic
1155434229 18:25794599-25794621 CCACTTAGGTGAAGGCTGACTGG + Intergenic
1155784995 18:29884565-29884587 CCACTGAGATGGAGCCTCCTCGG - Intergenic
1156076334 18:33283044-33283066 CCACTGTGGTGAAAGCTAGCAGG + Intronic
1157025335 18:43836015-43836037 CCACAGAGGTGGAGTCTAGAGGG - Intergenic
1158938253 18:62384580-62384602 CCACTGAGGCGGAGGAAGGCGGG - Intronic
1161442151 19:4298069-4298091 CCGCTGTGGTTGAGGCTCACAGG + Exonic
1162284193 19:9725997-9726019 CCACTGAGGTGGAAGCTCACTGG + Intergenic
1163252373 19:16133730-16133752 CCTCTGAGGTGGCCGCTCGATGG - Exonic
1163784288 19:19266679-19266701 CCCCTGAGGTGGAGGCCCTGAGG + Intronic
1163848597 19:19651136-19651158 CCACAGAGGAGGAAGCTGGCTGG - Intronic
1163943196 19:20513711-20513733 CCACTGAGGTGGAGCCTCACTGG + Intergenic
1163966361 19:20750703-20750725 CCACCAAGGTGGAAGCTCACTGG + Intronic
1164400489 19:27898821-27898843 CCACAGAGGACGAGGCTCCCAGG - Intergenic
1165055477 19:33173752-33173774 TCACAGAGGAGGAGGCTCCCAGG - Intronic
1166011958 19:39949248-39949270 CCAGAGAGGTGGAGGCTATCTGG + Intergenic
1166379643 19:42349322-42349344 CCCCTGAGGAGGAGGGTCCCTGG + Intronic
1166948585 19:46412117-46412139 CCACTGCGGTGGAGGCCAGCCGG + Exonic
1167942610 19:52959806-52959828 CAACCGAGGTGGAAGCTCGCTGG - Intronic
926104607 2:10142416-10142438 CCACTGTGGAGGTGGCTTGCGGG + Intronic
930518564 2:52435634-52435656 CAATCGAGGTGGAAGCTCGCTGG - Intergenic
930570124 2:53076092-53076114 CTACTGAGGAGGTGGCTCACTGG - Intergenic
931713052 2:65006125-65006147 CAGCTGAGGTGGATGCTCACAGG - Intronic
932349955 2:71023720-71023742 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
933057694 2:77693506-77693528 CCTCTGAGGTTGAGGGTAGCAGG + Intergenic
933767530 2:85720299-85720321 CCACTGAAGCTGAGGCTCGAAGG + Intergenic
935618823 2:105111502-105111524 CACCTGAGGTGCAGCCTCGCTGG - Intergenic
937089835 2:119198784-119198806 CCACTCAGGTAGAGGCTCTAGGG + Intergenic
939178894 2:138781352-138781374 ACACGGAGGTCGAGGCTCACAGG - Intergenic
940872211 2:158869495-158869517 CCACCAAGGTAGAAGCTCGCTGG - Intergenic
940874418 2:158885483-158885505 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
945174048 2:207023715-207023737 CCACTGTGGTGCAGGGTCACAGG - Intergenic
945791380 2:214309834-214309856 CCACTGTGGTGAATGCTCTCAGG - Intronic
946891897 2:224285223-224285245 ACAGTGAGATGGAGGCTCGCAGG - Intergenic
947595015 2:231405641-231405663 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
947634620 2:231673634-231673656 GCACTGTGGTGGAGCCTGGCTGG - Intergenic
948929954 2:241125813-241125835 CCACTGAGGTGGGGGCTGGTGGG + Intronic
1168965004 20:1893933-1893955 CCAGGGAGGTGGAGGCCCCCTGG - Intergenic
1171408558 20:24930359-24930381 CCACCAAGATGGAAGCTCGCTGG - Intergenic
1175592385 20:60203552-60203574 CCACAGAGGTCCAGGCTCCCTGG - Intergenic
1176742022 21:10613660-10613682 CCACTCAGCTGGAGGCCTGCTGG - Intergenic
1178447727 21:32660906-32660928 CCACTGAGGTGGAGGCTCGCTGG - Intronic
1178760592 21:35398543-35398565 CCTCTGAGGTGGAGACTGCCAGG + Intronic
1179621043 21:42616723-42616745 CCAGTGAGGTCCACGCTCGCTGG + Intergenic
1180563904 22:16646895-16646917 CCACTCAGCTGGAGGCCTGCTGG - Intergenic
1183599044 22:38829426-38829448 CCTCTGGGGTGGAGGAACGCAGG + Intronic
1184731005 22:46371128-46371150 CCACTGAGGTGGGGGCAGGTTGG - Intronic
1184741690 22:46432204-46432226 CCAGGGAGGTGGAGGGACGCCGG + Intronic
1184884001 22:47330998-47331020 CCACTGAAGTGAAGGCCCCCTGG + Intergenic
1185285066 22:49996440-49996462 CCACTGAGGCCCAGGCTCCCAGG - Exonic
949884573 3:8683081-8683103 CCAGCAAGGTGGAAGCTCGCTGG - Intronic
950442203 3:13016572-13016594 GCACAGAGGAGGAGGCTGGCAGG - Intronic
951165997 3:19485771-19485793 CCACTGAGGTGGAGGCTCGCTGG + Intronic
953034217 3:39198059-39198081 CCGGGGAGGTGGAGGCTCGGAGG - Intergenic
953892610 3:46764835-46764857 TCACTGAGGTGTAGGCACACAGG + Intronic
955516774 3:59733591-59733613 GCAGTGAGGTGGAGGTTCACTGG + Intergenic
957044379 3:75362599-75362621 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
957245490 3:77711301-77711323 CCACAGAGGTGGAGACTGGAGGG - Intergenic
958459063 3:94371169-94371191 CCACTGTGGTGAATGCTCACAGG - Intergenic
961275123 3:125720400-125720422 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
961876373 3:130026633-130026655 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
961892832 3:130144790-130144812 CAACCAAGGTGGAAGCTCGCTGG + Intergenic
962030855 3:131598883-131598905 CCATGGAGGAGGAGCCTCGCTGG + Intronic
962335530 3:134527176-134527198 CCACTGTGGTGAATGCTCTCAGG - Intronic
962806869 3:138933818-138933840 CCAGTGAGGTTCAGGCTCGTTGG + Intergenic
963141495 3:141949563-141949585 CCACTGAGGGCCAGGCACGCAGG + Intergenic
964522385 3:157583079-157583101 CCACTGAGGTGGAGGCTTGCTGG + Intronic
966320748 3:178699048-178699070 CCACTGTGGTGGATGCCCACAGG - Intronic
966880398 3:184346675-184346697 CCACTGAGGTGCATGCACTCTGG - Exonic
968988643 4:3893839-3893861 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
969024328 4:4161482-4161504 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
969025236 4:4167428-4167450 CCACCAAGGTGGAAGCTTGCTGG + Intergenic
969239556 4:5889563-5889585 CCAGTGAGGTTGGGGCTTGCTGG - Intronic
969729489 4:8945683-8945705 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
969734232 4:8976325-8976347 CCACCAAGGTGGAAGCTCGCTGG - Intergenic
969789076 4:9479622-9479644 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
969793815 4:9510390-9510412 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
971328373 4:25662780-25662802 CCACTGAGGTGGATGACCCCTGG + Exonic
972077484 4:35105365-35105387 TCACTGAGGTGGAAACTCACTGG - Intergenic
975245866 4:72120069-72120091 CCACTAAGCTGGAGCCTCCCAGG - Intronic
976970014 4:91092881-91092903 TCACTGAGGTGGAAGCTCACTGG + Intronic
978606189 4:110482334-110482356 CAATTGAGGTGAAGGCTAGCTGG - Intronic
980343566 4:131583472-131583494 CCACTGCTGTGGAGGCTCTCTGG - Intergenic
980780160 4:137483175-137483197 CCACTGAGGTGGAGGCTCGCTGG - Intergenic
981932656 4:150207887-150207909 CCACTGTAGTGGAGCCTTGCAGG + Intronic
982630019 4:157819959-157819981 CCACTGAGGTGAATGCCCACAGG + Intergenic
985239879 4:187918978-187919000 CCTCTGAGGTAGAGGCTAGTGGG + Intergenic
987856140 5:23423061-23423083 CCACTGATATGGTGGCTCTCAGG + Intergenic
988870651 5:35385356-35385378 CCACTGTGGTGTAGGCCTGCAGG + Intergenic
993461755 5:88190619-88190641 CCACCAAGGTGGAAGCTCGCTGG + Intronic
995473843 5:112528772-112528794 CCACTGAGGTGGAGGCTTGCTGG - Intergenic
996687348 5:126297341-126297363 CCACTGAGGTACAGGCACACTGG + Intergenic
1002408118 5:179052307-179052329 TTACTGAGGTGGAAGCTTGCAGG + Intergenic
1002465108 5:179404469-179404491 CCACTGAGCTGGAGCCCTGCTGG + Intergenic
1002929469 6:1623610-1623632 AGACTAAGGAGGAGGCTCGCCGG + Intergenic
1004053973 6:12115830-12115852 CCTCTGAGGCAGAGGCTCGCGGG + Intronic
1004351266 6:14892274-14892296 CCAGTGAGATGGAGGCTCTCAGG - Intergenic
1004555654 6:16695069-16695091 CCACTGAAGTGGTGGCTCTTGGG + Intronic
1006253082 6:32807263-32807285 CCACTGTGGTGGATGCCTGCAGG - Intergenic
1007315974 6:40989535-40989557 CCACTAAAGCGGAGGCTCGGTGG + Intergenic
1010214452 6:73389199-73389221 CTCCTGAGGTTGAGGCTTGCCGG + Intronic
1012611678 6:101227019-101227041 CAATCGAGGTGGAAGCTCGCTGG + Intergenic
1020138436 7:5599195-5599217 CCAGTGCGGTGGATGCTCGTCGG + Intronic
1020307005 7:6843109-6843131 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1020311488 7:6871953-6871975 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
1020323054 7:6954291-6954313 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1022030994 7:26491805-26491827 CCACTTAGCTGGAGACTTGCAGG + Intergenic
1022522378 7:31016524-31016546 CCACTGAGGTGCAGTCTGGTGGG + Intergenic
1022547039 7:31199513-31199535 CCATTGAGATGGTGGCTGGCAGG + Intergenic
1023968053 7:44973583-44973605 CCACTGAGGTGGGAGCTCCCTGG - Intronic
1023968143 7:44974033-44974055 GCACTGAGGTGGGAGCTCACTGG - Intronic
1023968153 7:44974076-44974098 CCACTGAGGTGGGAGCCCCCTGG - Intronic
1023968258 7:44974704-44974726 CCACTGAGGTGGGAGCTCCCTGG - Intronic
1024238955 7:47419236-47419258 CCACAGAGTTGGAGGCTCAGAGG + Intronic
1025624031 7:63202254-63202276 CAATTGAGGTGAAGGCTAGCTGG - Intergenic
1026400906 7:70011912-70011934 CCACTGTGTAGGAGGCTCCCAGG - Intronic
1029078160 7:97952053-97952075 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1032170787 7:129582956-129582978 CAATCGAGGTGGAAGCTCGCTGG - Intergenic
1034645768 7:152645814-152645836 AGGCTGAGGTGGAGGCTCACTGG + Intronic
1035663629 8:1364598-1364620 CCACTGAAGAGGCGGCACGCCGG - Intergenic
1036239844 8:7072450-7072472 CCACCAAGTTGGAGGCTCGCTGG - Intergenic
1036491606 8:9231363-9231385 CCAATCAGGTGGAGCCTCTCTGG + Intergenic
1036653379 8:10660209-10660231 TCACTGGGGTTGTGGCTCGCAGG + Intronic
1036903491 8:12689115-12689137 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
1036905989 8:12708794-12708816 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1038292286 8:26260615-26260637 CCACTGAGCTGGTGCCTCCCAGG + Intergenic
1038799138 8:30733499-30733521 CCACCAAGGTGGAAGCTCGCTGG - Intronic
1038847783 8:31245719-31245741 CCACAGAGGCAGAGGCTCTCAGG - Intergenic
1039278398 8:35956399-35956421 CAATCGAGGTGGAAGCTCGCTGG - Intergenic
1039915905 8:41860119-41860141 CCACTGGGGTGGGGGCTGGAGGG + Intronic
1046012081 8:108561355-108561377 CCACTGAGGACAAGGCTCCCAGG - Intergenic
1047438334 8:124854284-124854306 CCAGTGAGGTGGAGGGGTGCTGG - Intergenic
1047693990 8:127384909-127384931 GCACTAAGGTGAAGGCTGGCTGG + Intergenic
1048450300 8:134527621-134527643 GCACTGAGGTGGAGGGTTCCTGG + Intronic
1048957362 8:139548019-139548041 CCACCAAGGTGGAAGCTCACTGG + Intergenic
1049062443 8:140286650-140286672 GCACTGAGATGGAGGCTTGACGG + Intronic
1049195360 8:141312810-141312832 CCACGGAGGTGGAGGCTAGAGGG + Intergenic
1051608806 9:18942090-18942112 CCAATGAGGTGGAGGGGCACTGG - Intronic
1052514543 9:29462914-29462936 CCACTGTGGTGAAGGCTTGCAGG + Intergenic
1053013446 9:34648269-34648291 CCAATGATGTGGAGGCTTGGAGG + Intronic
1056865860 9:90226958-90226980 CCAGCAAGGTGGAAGCTCGCTGG - Intergenic
1056917160 9:90755949-90755971 CCAGCAAGGTGGAAGCTCGCTGG + Intergenic
1057263276 9:93598080-93598102 CAGCTGGGGTGGAGGCTGGCAGG + Intronic
1057622687 9:96650257-96650279 CCACTGTGTTGGATGCTCCCAGG - Intronic
1060521960 9:124299058-124299080 CCACTGGGGAGGAGCCTAGCGGG - Intronic
1061767018 9:132887941-132887963 CCACTGTGCTGCAGGCTCCCGGG - Intronic
1061902099 9:133678204-133678226 CCACTGTGGTGGAGGCTGGTGGG - Intronic
1062212151 9:135370964-135370986 CCCCTGAAGTGGAGGGCCGCTGG - Intergenic
1062224072 9:135439101-135439123 CCACCAAGGTGGAAGCTCGCTGG + Intergenic
1185909978 X:3972309-3972331 CCACTGAGATGGAGGCTCGCTGG - Intergenic
1190425829 X:50333824-50333846 CCACTGAGATGGAGGCTCGCTGG + Intronic
1190506358 X:51130137-51130159 CCACTGTGGTGAATGCTTGCAGG - Intergenic
1191036020 X:56027316-56027338 TCACTGAGGTGGAAACTTGCTGG + Intergenic
1191633608 X:63351581-63351603 CCACTGTGTAGGAGGCTGGCGGG - Intergenic
1193960178 X:87915015-87915037 CCACTGTGGTGAATGCTGGCAGG + Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1200394064 X:155972792-155972814 CCACTGAGGTGGAAGCTCGCTGG + Intergenic
1200943391 Y:8807856-8807878 CCACTGAGGTGGAGGATCACTGG - Intergenic
1201555116 Y:15259157-15259179 CCACTGATATGGAGGCTTACTGG - Intergenic