ID: 951166009

View in Genome Browser
Species Human (GRCh38)
Location 3:19485884-19485906
Sequence AAGGGCCTGTTAAACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 8, 2: 9, 3: 46, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951166009_951166016 17 Left 951166009 3:19485884-19485906 CCCCCAGGGTTTAACAGGCCCTT 0: 1
1: 8
2: 9
3: 46
4: 147
Right 951166016 3:19485924-19485946 CATGCACTTGAGAATTAGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951166009 Original CRISPR AAGGGCCTGTTAAACCCTGG GGG (reversed) Intronic
900932469 1:5745965-5745987 ATGGGCCTGCTGACCCCTGGTGG + Intergenic
901124121 1:6917298-6917320 CAGGGCCTGGTAAGCCGTGGTGG + Intronic
902488562 1:16764188-16764210 AATGGCCTGTAAACCCCTTGAGG + Intronic
904863915 1:33561619-33561641 AAGCGGCTGTTAAACCCAGTGGG + Intronic
905262681 1:36730709-36730731 AAGGGGCAGCTCAACCCTGGAGG - Intergenic
905913917 1:41672168-41672190 AAGGACCTGGCAAACCATGGAGG - Intronic
906252114 1:44318656-44318678 ATGAGCCTGTTTGACCCTGGTGG - Intronic
906293147 1:44632606-44632628 AAGGCCCTGAAGAACCCTGGGGG + Intronic
906791476 1:48661874-48661896 AAGGGGTTGGTAAACCCAGGAGG + Intronic
910805659 1:91188065-91188087 AAGTGTCTGTTGAACCCTGCTGG + Intergenic
911973357 1:104463726-104463748 AAAGGCCTGTTGAACTCAGGGGG - Intergenic
914142501 1:144963179-144963201 AAGAGGCTGTTAAACCCTCTTGG + Intronic
915513811 1:156401263-156401285 AGGGGCCTGATACACCCTGAGGG - Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919584979 1:199426073-199426095 AAGGGAATGTTATACACTGGTGG + Intergenic
919599075 1:199600183-199600205 AAGTGCCTGTTGACCCCTGCTGG - Intergenic
922855682 1:228773336-228773358 AAAAGCCAGTTAAACCCGGGAGG + Intergenic
923531875 1:234818328-234818350 AATGGCCTGTAAACCCCTTGAGG - Intergenic
1063014958 10:2066739-2066761 AAGAGCTTCTTGAACCCTGGAGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064709362 10:18108048-18108070 AAGAGTCTCTTGAACCCTGGAGG - Intergenic
1065235234 10:23643856-23643878 AAGGAACTGTTAAACACTGAAGG + Intergenic
1065945017 10:30598266-30598288 AAGGGCCTATTAAACACAGCCGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1076905779 10:133360186-133360208 AAGAGCCTGTTATGCCCTGTTGG + Intergenic
1077242870 11:1520153-1520175 GAGGATCTGTTAAACCCAGGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1083298321 11:61727115-61727137 AAGGTCCTGTTAGACACTGATGG + Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1091795136 12:3293774-3293796 GAGGGACTTTTAAACCCTGAGGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093178693 12:15943521-15943543 AAGGACCTTTTAAACCCTGTTGG + Intronic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1096492082 12:52018552-52018574 CAGGCTCTGTTAGACCCTGGAGG - Intergenic
1096541826 12:52312319-52312341 AAGGGAGTGTTAAACCCCAGAGG + Intergenic
1096788588 12:54031648-54031670 AAGGGCCCGGAAAACTCTGGCGG - Intronic
1097044626 12:56178339-56178361 AACAGCCTGTTGACCCCTGGAGG + Intronic
1097366194 12:58716045-58716067 AAGGGCCTGTCAACCCTGGGTGG - Intronic
1098101793 12:67025661-67025683 AATTGCGAGTTAAACCCTGGGGG - Intergenic
1098726444 12:73973952-73973974 AAGGCCCTCTTAACCCATGGTGG - Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1106081739 13:26506242-26506264 AAGTCCCTGATACACCCTGGGGG + Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1112664621 13:101555437-101555459 AAGGTCCTGATACACACTGGTGG - Intronic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1118875267 14:69779069-69779091 GAGGATCAGTTAAACCCTGGAGG + Intronic
1122973355 14:105161250-105161272 CAGTGACTGTTAAAGCCTGGTGG - Intronic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1134205039 16:12230536-12230558 AAGGGCCTGTTCAACATTAGGGG + Intronic
1136006274 16:27331577-27331599 GAGGGCCTGATAATCCCAGGAGG - Intronic
1137564607 16:49525205-49525227 AAGGGCCTGTTAATCCCTCAGGG + Intronic
1144113266 17:12060086-12060108 AAGGGTCAGTTGAGCCCTGGAGG + Intronic
1145303762 17:21658224-21658246 AAGGGCCAGTGAGAGCCTGGGGG + Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1146552570 17:33794350-33794372 AAGGGCATTTTACACCCTGAGGG - Intronic
1147582239 17:41634048-41634070 AAGGGCCTGTGGACACCTGGCGG - Intergenic
1147705350 17:42421973-42421995 AAGGGCCTGAAAATGCCTGGTGG + Intronic
1147930561 17:43977862-43977884 AGGGGCCTGTGAACCCCTTGAGG + Intronic
1148465808 17:47864715-47864737 GAGGGCCTGTTAGAGGCTGGGGG - Intergenic
1158171167 18:54602583-54602605 AAGGTCCCTTTAAACCCTGCTGG - Intergenic
1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG + Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163916790 19:20247099-20247121 ACAGGCCTGTTAAACTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1166360284 19:42250267-42250289 AAGGGGCTGTGCAACCCCGGGGG + Intronic
1168021660 19:53613237-53613259 AAGCGCCTGTCAAACTCTTGTGG + Intergenic
1202702636 1_KI270713v1_random:52-74 AATGGCCTGTAAACCCCTTGAGG - Intergenic
927112995 2:19877606-19877628 GAGAGCCTCTTGAACCCTGGAGG + Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
938170104 2:129068672-129068694 AGGGGCTTGTCACACCCTGGAGG - Intergenic
940200475 2:151144482-151144504 AAGGGCATTTTAAAAACTGGCGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
944525928 2:200619465-200619487 AGTGGCCTGCTAAGCCCTGGTGG - Intronic
946690886 2:222307360-222307382 CAGGCGCTGCTAAACCCTGGCGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170123780 20:12939099-12939121 AAGGTCCTGCCATACCCTGGAGG - Intergenic
1170125354 20:12957031-12957053 AGGGTCCTGCTATACCCTGGAGG - Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171521291 20:25775872-25775894 AAGGGCCAGTGAGAGCCTGGGGG + Intronic
1171555521 20:26080001-26080023 AAGGGCCAGTGAGAGCCTGGGGG - Intergenic
1173004478 20:39129178-39129200 AAGGGCCTAGGAAGCCCTGGAGG + Intergenic
1173296832 20:41767096-41767118 CAGGGCCTGTTCAAGGCTGGTGG + Intergenic
1174022767 20:47544411-47544433 AAGGACCGCTTAAACCCAGGAGG - Intronic
1176655122 21:9580984-9581006 AAGGGCCAGTGAGAGCCTGGGGG + Intergenic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1180026815 21:45169190-45169212 AAGGGGTTGTTAGAGCCTGGTGG + Intronic
1180647037 22:17347810-17347832 AAGGGCTTGCTACACCCTGCTGG + Intergenic
1180726966 22:17953460-17953482 AAGGTCATGTTAAGGCCTGGGGG + Intronic
1184153235 22:42650292-42650314 GAGGATCTGTTGAACCCTGGAGG - Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949274199 3:2258876-2258898 AAGTGCCTGAGAAACACTGGTGG - Intronic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
951492211 3:23283876-23283898 CAGGGCCTTTTAAACACTGTTGG - Intronic
953194175 3:40716169-40716191 AAGGGACAGGTAGACCCTGGAGG - Intergenic
956619800 3:71210478-71210500 AAGGACCTGTTAACACCTGATGG + Intronic
956763793 3:72466814-72466836 AAGGTTTTGTTATACCCTGGAGG + Intergenic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
964276907 3:155018541-155018563 AAAGGCCAGGAAAACCCTGGAGG - Intergenic
964344139 3:155738859-155738881 AAGGACCTCTTGAGCCCTGGAGG + Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
966759823 3:183407973-183407995 AAGGGCCTGTGAAACCCTGAGGG + Intronic
967813676 3:193781249-193781271 AAGGGCAGGTCACACCCTGGAGG + Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969749920 4:9102238-9102260 AAGGGCCTACTGAACCCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970583612 4:17494928-17494950 AAGGGCCTTGGAAACCATGGAGG + Intronic
972077472 4:35105252-35105274 AAAGCCCTGTTAAATTCTGGGGG + Intergenic
977564428 4:98567040-98567062 ATTGGCCAGTTAAACCCTGGGGG - Intronic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
984730574 4:183064673-183064695 CAGGGCCTGGTTGACCCTGGAGG + Intergenic
984735843 4:183107249-183107271 GAGGATCTGTTGAACCCTGGAGG - Intronic
985714142 5:1446152-1446174 ACGGGCCTGGAAAGCCCTGGCGG + Intergenic
988714054 5:33807150-33807172 AAGGGAATGTGGAACCCTGGAGG - Intronic
993320473 5:86463358-86463380 AAAGGCTTGTTAAACTCTGGAGG + Intergenic
994379833 5:99057818-99057840 TAGGGCCAGCTAAACGCTGGAGG + Intergenic
995224501 5:109688984-109689006 GACAGCCTGTTAAAACCTGGGGG - Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
1001961673 5:175883594-175883616 AGGGGCCTGTGGAACCCTAGAGG - Exonic
1004986180 6:21085487-21085509 AAAGGGCTGTTAAAACTTGGGGG + Intronic
1006075852 6:31531905-31531927 AAGGATCTCTTAAACCCAGGAGG - Intronic
1008615486 6:53221860-53221882 GAAGGCCTGTTGATCCCTGGGGG + Intergenic
1008711337 6:54230707-54230729 GAGGGACTGTTACATCCTGGTGG - Exonic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013159924 6:107533078-107533100 AAGGTCCTGTGAAAGCCTGCAGG - Intronic
1013583959 6:111562043-111562065 CAGGCCCTGTTTCACCCTGGAGG - Intronic
1014307487 6:119759605-119759627 AAGTGTCTGATAAAACCTGGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1025281758 7:57630829-57630851 AAGGGCCAGTGAGAGCCTGGGGG + Intergenic
1025302971 7:57834688-57834710 AAGGGCCAGTGAGAGCCTGGGGG - Intergenic
1025713958 7:63937207-63937229 AAGGGCATGTTATACTCTGTTGG + Intergenic
1028803914 7:95002152-95002174 AATGGCCTCTTAATCACTGGGGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029265707 7:99338350-99338372 AAGAGCCTAATAAACCCAGGTGG + Intronic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1032319903 7:130876321-130876343 AATGACCTGTTTAACCATGGAGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1036906000 8:12708907-12708929 AAAGGCCTGCTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038872146 8:31506327-31506349 AAGGGAATGTTATACCCTGTTGG - Intergenic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041347875 8:56920365-56920387 AAGGGGCAGTTAAACACTGAGGG + Intergenic
1041838259 8:62241665-62241687 AAGTGCTTGTTGAACCCTGCTGG + Intergenic
1042101840 8:65282609-65282631 ACTGGACTGTCAAACCCTGGAGG + Intergenic
1043843518 8:85137283-85137305 AAAGGCCTCTTAAACACTTGTGG - Intronic
1048182951 8:132213231-132213253 AAGGGACAGTTAAGCTCTGGTGG - Intronic
1048260722 8:132943082-132943104 AAGGGGCTCTTATACCCAGGAGG - Intronic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1049106544 8:140617339-140617361 GAGGGTCACTTAAACCCTGGAGG - Intronic
1051611876 9:18969181-18969203 AAGAGCCTGTTTTACCCAGGTGG - Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1059031611 9:110703438-110703460 AAGGATCTCTTAAACCCAGGAGG + Intronic
1060605182 9:124907672-124907694 ATGTGCCTGTTAATTCCTGGGGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1203632844 Un_KI270750v1:84437-84459 AAGGGCCAGTGAGAGCCTGGGGG + Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1188405791 X:29807523-29807545 AAGAGCCTCTTGAACCCGGGAGG + Intronic
1190425839 X:50333937-50333959 AAGGGTCTGCTAAACTCTGGGGG - Intronic
1191036032 X:56027429-56027451 AAAGGCCTGTTAAATTCTGGGGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1199712963 X:150484884-150484906 AAAGGGCTCTTAAACCTTGGGGG - Intronic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200729995 Y:6724419-6724441 CAGGGCCTGTTACAGCGTGGGGG + Intergenic
1200912156 Y:8540210-8540232 AAGCACCAGTTAAACTCTGGAGG + Intergenic
1200925304 Y:8648985-8649007 AAGGTCCTGTTAAACTCTGAAGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201270353 Y:12248009-12248031 AAAGCCCTGTTAAATTCTGGAGG + Intergenic
1201377169 Y:13335177-13335199 CAGGGCCTGTCAAAGGCTGGGGG + Intronic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1201680512 Y:16640056-16640078 AAAGCCCTGTTAAATTCTGGAGG - Intergenic
1202037305 Y:20647990-20648012 AAAGGCCTGTTGAACACTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic