ID: 951166523

View in Genome Browser
Species Human (GRCh38)
Location 3:19489446-19489468
Sequence ATTGATACGGGAATTGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951166517_951166523 3 Left 951166517 3:19489420-19489442 CCAAGAATCTATATGTATATACG 0: 1
1: 0
2: 1
3: 13
4: 238
Right 951166523 3:19489446-19489468 ATTGATACGGGAATTGATCTGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951166523 Original CRISPR ATTGATACGGGAATTGATCT GGG Intronic