ID: 951166523 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:19489446-19489468 |
| Sequence | ATTGATACGGGAATTGATCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 73 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 68} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 951166517_951166523 | 3 | Left | 951166517 | 3:19489420-19489442 | CCAAGAATCTATATGTATATACG | 0: 1 1: 0 2: 1 3: 13 4: 238 |
||
| Right | 951166523 | 3:19489446-19489468 | ATTGATACGGGAATTGATCTGGG | 0: 1 1: 0 2: 0 3: 4 4: 68 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 951166523 | Original CRISPR | ATTGATACGGGAATTGATCT GGG | Intronic | ||