ID: 951168070

View in Genome Browser
Species Human (GRCh38)
Location 3:19506575-19506597
Sequence TGGGCTCCTCTCCCACTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 0, 2: 4, 3: 18, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951168066_951168070 -2 Left 951168066 3:19506554-19506576 CCTCTCAGTGCTCTGACAGTGTG 0: 1
1: 34
2: 57
3: 125
4: 264
Right 951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG 0: 2
1: 0
2: 4
3: 18
4: 233
951168065_951168070 -1 Left 951168065 3:19506553-19506575 CCCTCTCAGTGCTCTGACAGTGT 0: 1
1: 29
2: 77
3: 114
4: 299
Right 951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG 0: 2
1: 0
2: 4
3: 18
4: 233
951168064_951168070 20 Left 951168064 3:19506532-19506554 CCTCATGATTGCAGCTATGCTCC 0: 1
1: 2
2: 17
3: 26
4: 166
Right 951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG 0: 2
1: 0
2: 4
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951168070 Original CRISPR TGGGCTCCTCTCCCACTTGA GGG Intronic
900744823 1:4353897-4353919 TGAGGTCCTCTCCAACATGATGG - Intergenic
902302216 1:15510270-15510292 TGGGCTCCACTGCAACTTGGAGG - Intronic
902551722 1:17223422-17223444 TGGGCTCCACAGCCACTTGCTGG + Intronic
903884387 1:26532435-26532457 TGAGCCTCTCTCCCACTTGGTGG - Intronic
904023032 1:27482997-27483019 TGTGCTCCTCTTCCATTTCATGG - Intronic
908852975 1:68392501-68392523 TTGGGTCCCCTCCCACTTTATGG - Intergenic
908928582 1:69288144-69288166 TGGGCTCGGCTTCCTCTTGAAGG + Intergenic
910338339 1:86157191-86157213 TGGTCTCCTTTCCCACTTATAGG + Intergenic
910494630 1:87812914-87812936 TCGGCTGGTTTCCCACTTGATGG - Intergenic
910603795 1:89060324-89060346 TGGTCTCCTCTCTCCCTTGCAGG - Exonic
910637035 1:89420169-89420191 TGGTCTCCTCTCTCCCTTGCAGG + Intergenic
913936957 1:125064520-125064542 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
915512882 1:156396255-156396277 TGGGCTCCCCTCAGATTTGAGGG - Intergenic
915959721 1:160255429-160255451 TGGCCTCTTCTCCCTCTTGAAGG + Intronic
917403545 1:174679039-174679061 TTGGGTCCCCTCCCACTTCATGG - Intronic
920802999 1:209207120-209207142 AGAGCTCCTCTCCCACTCGCTGG + Intergenic
921343164 1:214154475-214154497 TGGGCTCATCTCTCTCTGGATGG - Intergenic
922187380 1:223287438-223287460 TCTGCTCCTCTCCCACTCAAAGG + Intronic
922240989 1:223755451-223755473 TGGGCTCCTCTGCCCCTTTCTGG + Intronic
923730714 1:236547135-236547157 TGTGCTCCTCGCCCCCATGAAGG - Intronic
924701135 1:246453962-246453984 TCGGCTCCTATTCCACTTTAAGG + Intronic
1063096089 10:2910367-2910389 CGGCCTCCTCTCCGTCTTGATGG - Intergenic
1063611192 10:7563286-7563308 CAGGCCCCTCTCCCACCTGAAGG + Exonic
1065218365 10:23472300-23472322 GGGGCTCTTCGCTCACTTGAGGG - Intergenic
1069856978 10:71446644-71446666 TGGATTCCTCTTGCACTTGAAGG + Intronic
1074556911 10:114499879-114499901 TGGAAGCCTCTCCCAGTTGAGGG - Intronic
1074714071 10:116202236-116202258 TGGGCAGAACTCCCACTTGAGGG + Intronic
1076177573 10:128379897-128379919 TGGGCTTCTCTCCCCCTTTCTGG - Intergenic
1076995111 11:293959-293981 TGGGCTCCACTCCCACCACAAGG - Intronic
1077207256 11:1350483-1350505 TGGGCTCCTCTCCCTCCAGCTGG + Intergenic
1078840723 11:15073849-15073871 TGGGCTCCTCTCGCACTGGTAGG - Intronic
1082955747 11:58868058-58868080 TAGGCTCCTCTCCCATCTGTAGG - Intronic
1082972357 11:59037059-59037081 TGGGCTCCTCTCCCATCTGTAGG - Intronic
1082976830 11:59080943-59080965 AGGGCTCCTCTCCCATCTGTAGG - Intergenic
1083508092 11:63179736-63179758 TGAGCTCCTTTCCCTCCTGAGGG + Intronic
1083808477 11:65088759-65088781 GGGGCCACTCTCCCACTGGATGG - Intronic
1085024491 11:73228641-73228663 TGGGCTCCTGTGGCAGTTGAAGG + Intronic
1088402409 11:109435810-109435832 TGTGACCCACTCCCACTTGAAGG + Intergenic
1089054923 11:115577821-115577843 TGGGCTCCTCTCTCAGGGGATGG - Intergenic
1090188434 11:124752808-124752830 TGGGCTCCTCTCCCACACCACGG - Intronic
1091969237 12:4772035-4772057 TGTGCTTCTCTCCCTCTTCAGGG - Intronic
1093144956 12:15554254-15554276 TGGAATCCTCTCTCAGTTGATGG - Intronic
1095038360 12:37418796-37418818 TGGGCTGCTCTCTCACCCGACGG - Intergenic
1102513762 12:113433334-113433356 TGGCCTCCTCTCCCAAGGGAGGG - Intronic
1103494463 12:121350832-121350854 TGGCCTTCTCTCCCATTAGACGG - Intronic
1104151672 12:126090464-126090486 AGGACTCCTCTCCCACTGCAGGG + Intergenic
1105618679 13:22045959-22045981 TGGGCTCCTCTGCCACATCCTGG - Intergenic
1110578185 13:77084937-77084959 TGGGCTCTTTTCCCAATTGTGGG + Intronic
1114480653 14:23032093-23032115 TGGGCTCCTCTCTTTTTTGAGGG - Intronic
1114726286 14:24941255-24941277 TTGTCTACTCTCCCACTAGATGG - Intronic
1114958268 14:27849790-27849812 TTGGTTCCTCTCCCACCTGGAGG - Intergenic
1115332943 14:32217621-32217643 TGTGTTCCTCTACCACGTGAGGG - Intergenic
1116025163 14:39505953-39505975 TTGACTTCTCTCCCACATGAAGG - Intergenic
1121318564 14:92976911-92976933 AAGGCTCCTTTCCCACTTCAGGG + Intronic
1122322595 14:100864406-100864428 TTAGCTCCTCTCCCAGTGGAAGG + Intergenic
1122722141 14:103728143-103728165 GGGCCTCCCCTCCCACCTGATGG - Intronic
1122789128 14:104176973-104176995 TGGGCTCCTCCTCCCCTCGAAGG - Exonic
1127810820 15:62563893-62563915 GGGTCTCTTCTCCCACTGGATGG + Intronic
1128916135 15:71564256-71564278 TGGGAACCTCTGCCCCTTGAAGG - Intronic
1134741350 16:16549890-16549912 TGGGCCTCTCTCCCGCTTCATGG + Intergenic
1134926208 16:18162551-18162573 TGGGCCTCTCTCCCGCTTCATGG - Intergenic
1136573272 16:31109101-31109123 GGGGCTCTTCTCCGACTTCAGGG - Exonic
1136690025 16:32022324-32022346 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1136790614 16:32965885-32965907 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1136879201 16:33888047-33888069 TTGGCTCCTCTCCCAGTTTTTGG - Intergenic
1137479472 16:48839828-48839850 TGGGCTCCTTCCTCTCTTGAGGG + Intergenic
1137816226 16:51400415-51400437 TGGGCTCCTCTGGCTCTAGAGGG + Intergenic
1138197115 16:55059858-55059880 TGGGTTACTCTCCCACTTCAAGG - Intergenic
1138323706 16:56142413-56142435 AGAACTCCTATCCCACTTGAGGG + Intergenic
1141598749 16:85112748-85112770 TGGGCTCCTCCCTCCCTTCAGGG + Intergenic
1203092816 16_KI270728v1_random:1227343-1227365 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1145293997 17:21574157-21574179 TGGGCTTCTCTCTCACCCGAGGG - Intronic
1145307210 17:21681993-21682015 TGGGCTGCTCTCTCACACGAGGG - Intergenic
1145307660 17:21684323-21684345 TGGGCTGCTCTCTCACACGAGGG - Intergenic
1145307895 17:21685488-21685510 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1145386009 17:22411818-22411840 TGGGCTGCTCTCTCACCTGAGGG + Intergenic
1147152881 17:38528470-38528492 TTGGCTCCTCTCCCAGTTTTTGG + Intergenic
1147670095 17:42171854-42171876 TGCGCTCCTTGCCCACTGGATGG - Exonic
1149284170 17:55143597-55143619 TGGGCTGGTCTCCCACTATAAGG + Intronic
1151414595 17:73952956-73952978 GGGGCTCCTCTCCCGCTGCAAGG + Intergenic
1151816692 17:76474636-76474658 TGGGCTCCTCACCCACCCGCAGG - Intronic
1153819156 18:8818107-8818129 TGGGCTGGGCTCCCACTAGACGG + Intronic
1153955530 18:10092753-10092775 TGGGCCCCCCTCCCACCTGCTGG - Intergenic
1158084726 18:53637664-53637686 TTGGCTCTTCTCCAGCTTGAAGG - Intergenic
1161361471 19:3852358-3852380 TGGGCTTCTCTGCCCCTGGAGGG + Intronic
1161924790 19:7292801-7292823 TGGGCCCCTCTCCCACGTGTGGG - Intronic
1162019046 19:7860445-7860467 TGGGCCCCTCTCCCTGCTGAAGG + Intronic
1162647500 19:12060530-12060552 TGGGCTCCTCTCCTACTCTGAGG + Intergenic
1164503188 19:28836421-28836443 TGGGCCCCTCTTCCATGTGAAGG + Intergenic
1164611605 19:29636343-29636365 GGGGCTTCCCTCCCACTTGCAGG - Intergenic
1164915802 19:32051580-32051602 TGGGCTCTCCTCCCTCTTGGTGG - Intergenic
1165230143 19:34381696-34381718 AGGGCTCCACTTCCACCTGAGGG + Intronic
1167429985 19:49448599-49448621 AGGGCTCGTCACCCACATGAAGG - Intronic
925278512 2:2667266-2667288 TGGGCTCCTGTCCCATCTGGAGG - Intergenic
925573251 2:5333865-5333887 TAGGATCCCCTCCCATTTGAGGG + Intergenic
926074980 2:9935317-9935339 TGGGCTGATCTCCCCCTGGATGG - Intergenic
927096634 2:19752150-19752172 TAGGATCCTCTCCCACATAATGG - Intergenic
928364777 2:30692232-30692254 TGGGGTCGTCTCCCTCTTCATGG - Intergenic
929095575 2:38260560-38260582 TGGGCTTCTCTCACATTAGAGGG + Intergenic
929646940 2:43637427-43637449 TGGGATCCCCGCCCCCTTGAGGG + Intronic
938221749 2:129575033-129575055 TGGGCCTCTCTCCCACTAGGTGG - Intergenic
939065912 2:137483148-137483170 TTGGTGGCTCTCCCACTTGAGGG + Intronic
944379947 2:199097025-199097047 TGGGCTCCTCTCCCACTCAAGGG - Intergenic
944887877 2:204083547-204083569 TGGGCTACTCTTCGACTTGCAGG - Intergenic
946154974 2:217801337-217801359 TGGGCCCCTCCCCCAGCTGAAGG + Exonic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
947602094 2:231459125-231459147 TGCCCTCCTCTCCACCTTGAAGG - Exonic
948835386 2:240623868-240623890 TGTGCTCCTCACACACTGGAAGG - Intronic
948994663 2:241572332-241572354 TGGCCTCCGCTCCCACTGGCTGG + Exonic
1169067410 20:2701816-2701838 TGGCCTTCTCTCCCACTAGGTGG + Intronic
1169075670 20:2758670-2758692 TGGGGTCGTCTCTCTCTTGAGGG + Intronic
1171530935 20:25853336-25853358 TGGGCTGCTCTCTCACTAGTGGG - Intronic
1171533606 20:25867870-25867892 TGGGCTGCTCTCTCACCCGAGGG - Intronic
1171543753 20:25985456-25985478 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1171837167 20:30168035-30168057 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1172991921 20:39042953-39042975 TGGCCACCGCTCCCACTTGTGGG + Intergenic
1174175866 20:48644599-48644621 TGGGCTGCACGCCCACCTGAGGG - Intronic
1174502324 20:50994646-50994668 GGGCCCTCTCTCCCACTTGAAGG - Intergenic
1175990579 20:62786519-62786541 TGGGCTCCTCTCCTATTCGCTGG - Intergenic
1176656453 21:9592503-9592525 TGGGCTGCTCTCTCACCTGAGGG - Intergenic
1176679310 21:9810933-9810955 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176679597 21:9812340-9812362 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176681021 21:9819380-9819402 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176682150 21:9825019-9825041 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176682429 21:9826428-9826450 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176682707 21:9827847-9827869 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176682987 21:9829244-9829266 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176683546 21:9832063-9832085 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176683826 21:9833466-9833488 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176684103 21:9834875-9834897 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1176684383 21:9836276-9836298 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1178932973 21:36835656-36835678 TGGGCACCTCTCCCAATCCAGGG + Intronic
1179444906 21:41424409-41424431 GGGGCTCCTCCCCCTCTTGTAGG + Intronic
1181040188 22:20188395-20188417 TGGGCTCCCATCCCACTTTCTGG - Intergenic
1182086759 22:27566289-27566311 TTGGCTCCTCTCACACTACAGGG - Intergenic
1182769684 22:32785494-32785516 AGTGCTTCTCTCCCACTTGCTGG - Intronic
1183174576 22:36213341-36213363 TTGGCTCCTCTCTGAGTTGATGG - Intergenic
1183386560 22:37518720-37518742 TGGGGTTCTCTCCCACTTCCTGG - Intronic
1184030557 22:41891961-41891983 TGGGCCCCTCCTCCACTTGCCGG - Intronic
1185019913 22:48367990-48368012 TGGGCTCTGCTCTCCCTTGAAGG - Intergenic
949131065 3:501864-501886 TGGGCCCCTCTACCACCTAAGGG + Intergenic
951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG + Intronic
956563771 3:70612800-70612822 TGGGGTCCTCTTCCATGTGATGG + Intergenic
957583971 3:82111029-82111051 TTGGCTCCTCCCCCTCCTGATGG + Intergenic
958878650 3:99644291-99644313 GAGGTTCCTTTCCCACTTGAGGG - Intronic
961358574 3:126353905-126353927 TTGTCTCCTTTCCCACTAGATGG - Intronic
961389509 3:126543921-126543943 TGGGCCCTTCCCCCACTGGAGGG + Intronic
961439914 3:126946531-126946553 CAGGCCCCTCTCCCACCTGAGGG + Intronic
962197414 3:133376308-133376330 GTGGCTCCTCTCCCACCTGAGGG + Intronic
963909914 3:150807992-150808014 AGGACTCCTCTCCCACTCCATGG - Intergenic
964480881 3:157137284-157137306 TGGGTTCCTCTCCCACCACACGG + Intergenic
965125987 3:164629660-164629682 TGATCTTCTCTACCACTTGATGG + Intergenic
969499943 4:7546523-7546545 TCACCTCCTCTCCCGCTTGAAGG - Intronic
970412149 4:15818700-15818722 TGGGTTCCTCCCGCACCTGAAGG - Intronic
974685610 4:65224067-65224089 TGTGCTCCTCTCCAGTTTGATGG + Intergenic
975059301 4:69978110-69978132 TGAGCTCCTTTCCCACTTGAAGG + Intergenic
975321083 4:73011201-73011223 TGGGCGCCACACCCACTTCAAGG + Intergenic
976416762 4:84785215-84785237 TGGGCTCCTCTCCTACTGCCCGG + Intronic
984112001 4:175628368-175628390 TAGGCTCCTCACCTCCTTGAGGG - Intergenic
984656386 4:182323070-182323092 CGGGCCACTCTCCCTCTTGAAGG + Intronic
986544396 5:8879849-8879871 GGGGCTCCTCTGCCTCTGGAAGG - Intergenic
986883767 5:12208548-12208570 TGGGCTCCTCTCCCACTCAAGGG + Intergenic
987323420 5:16791075-16791097 TAGGCTCCTCTGCTACTTGGTGG - Intronic
989209285 5:38844214-38844236 TGGGCTCCTATTGCAATTGAAGG - Intergenic
989256593 5:39372514-39372536 TGGCCTCCTCTTCCACAGGAAGG + Exonic
989273031 5:39554673-39554695 TGGGCCTCTCACCCACTTCAAGG - Intergenic
991684943 5:69173137-69173159 TCAGCTCCTCTGCCACTTGAGGG - Intronic
999363522 5:151006251-151006273 CTGGCTCCTCTGCCACTTAAGGG - Intergenic
1001242200 5:170079451-170079473 TGGGCTGCTCTCCCTTTTGGTGG - Intronic
1001995749 5:176156264-176156286 TGGGCTCCTCTATAACTGGAAGG - Intergenic
1002641256 5:180631655-180631677 TGGGTCCCTCTCCCACTGGCAGG - Intronic
1003816218 6:9843806-9843828 TGTGCTCCTTTCTCACTTTAAGG - Intronic
1004420333 6:15463863-15463885 TGGGCTGCTATCTGACTTGAGGG + Intronic
1005684619 6:28241212-28241234 TGGACTCCTTTCCCAATTAATGG - Intergenic
1007342152 6:41198133-41198155 TGGGATCCTGTACCCCTTGATGG - Exonic
1007348295 6:41249604-41249626 TGGGATCCTGTACCCCTTGATGG + Intergenic
1010183470 6:73115677-73115699 GGTGCTGCTCTCACACTTGATGG - Intronic
1017678179 6:156836563-156836585 TGTGCTCCTCTGCCAGATGAGGG + Intronic
1020089596 7:5331481-5331503 TGGCCTCCACTCTCACCTGAAGG - Intronic
1025284459 7:57650956-57650978 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1025284897 7:57653301-57653323 TGGGCTGCTCTCTCACCTGAGGG - Intergenic
1027995642 7:85423316-85423338 TGGGGGCCTCTCCCACTTCCAGG + Intergenic
1030741417 7:113114109-113114131 TGGACTCCACTCCCACCTGGTGG + Intergenic
1030926551 7:115462735-115462757 TGGCTTCCTATCTCACTTGAAGG + Intergenic
1032510641 7:132469625-132469647 TGGGCTACTTTCTCACTGGAAGG - Intronic
1033622602 7:143075729-143075751 TGGGCTACCCTCACTCTTGAAGG - Intergenic
1034457046 7:151176201-151176223 TGCGCTCCGCTCCCACCTGGAGG - Exonic
1034912593 7:155009555-155009577 TGGGCTCCTCTGCCAGCTCAAGG - Intergenic
1036523023 8:9509861-9509883 TGGGTTCCTCTCCATCTTGGTGG + Intergenic
1037324319 8:17673417-17673439 TGGCCTCACCTCCCACTGGAAGG + Intronic
1038333634 8:26629016-26629038 TGGGATCCTTTCAGACTTGAGGG + Intronic
1039570604 8:38583284-38583306 TGAGCTCGTCTCGCACTTGCTGG + Intergenic
1039602556 8:38852795-38852817 GGGGCTCCTCACACACTTCATGG - Exonic
1041234325 8:55784114-55784136 TGGGCTGCACTCCAGCTTGATGG - Intronic
1042157716 8:65863675-65863697 TGGCCTGCTCTCCCAGGTGAAGG - Intergenic
1044457418 8:92404084-92404106 AGGTCTTCTCTCCCACCTGAGGG - Intergenic
1046581820 8:116102638-116102660 TGGGCACCCATCCCTCTTGATGG - Intergenic
1046819608 8:118621388-118621410 TGGGGACCTCTCCCACGTGAGGG + Intronic
1047627214 8:126668428-126668450 TGGGCTCCTCTCCCACTGGTTGG - Intergenic
1048268135 8:133005369-133005391 TGGGCTCCTGTGCCCCTTAAAGG + Intronic
1048568769 8:135632308-135632330 TGGGCTCCTCTCTCTCTGGCTGG + Intronic
1049383126 8:142327349-142327371 TGTGCCCCTCTCCCACTGTAAGG - Intronic
1049801702 8:144520780-144520802 TGGGCTCCTCTCTCCTTTCAGGG + Exonic
1053473243 9:38361682-38361704 TGTGCTCCACTCGCACTTCATGG + Intergenic
1053558081 9:39159118-39159140 TGGGCTCTTCTCACACTTTCAGG + Intronic
1053784476 9:41644308-41644330 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1053784769 9:41646038-41646060 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1053822201 9:41979404-41979426 TGGGCTCTTCTCACACTTTCAGG + Intronic
1054139033 9:61459834-61459856 TGGGCTCTTCTCACACTTTCAGG - Intergenic
1054160249 9:61668144-61668166 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054160548 9:61669872-61669894 TGGGCTGCTCTCTCACCTGAGGG - Intergenic
1054160829 9:61671286-61671308 TGGGCTACTCTCTCACCCGAGGG - Intergenic
1054172433 9:61854441-61854463 TGGGCTGCTCTCTCACCCGAGGG + Intronic
1054172905 9:61856879-61856901 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054173203 9:61858280-61858302 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054173496 9:61859983-61860005 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1054447289 9:65383468-65383490 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054447763 9:65385913-65385935 TGGGCTCCTCTCTCACCGGAGGG + Intergenic
1054448063 9:65387325-65387347 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054448351 9:65389048-65389070 TGGGCTGCTCTCTCACCCGACGG - Intergenic
1054608374 9:67208009-67208031 TGGGCTCTTCTCACACTTTCAGG - Intergenic
1054664046 9:67720798-67720820 TGGGCTGCTCTCTCACCCGAGGG + Intergenic
1054664339 9:67722501-67722523 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1054664635 9:67723922-67723944 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG + Intergenic
1058138562 9:101334458-101334480 TGTGCTCCTCTGCCACTGTAAGG - Intergenic
1058710134 9:107672086-107672108 GGGTGTCCTGTCCCACTTGAGGG + Intergenic
1061261853 9:129484523-129484545 TGGGACCCTCTCCCACTACAGGG + Intergenic
1061798753 9:133103083-133103105 GGGGGTCCCCTCCCACTGGAGGG - Intronic
1062478361 9:136740585-136740607 TGGCCTCCGCTCCCCCTGGATGG + Intronic
1203634168 Un_KI270750v1:95985-96007 TGGGCTGCTCTCTCACCTGAGGG - Intergenic
1203664767 Un_KI270754v1:14875-14897 TGGGCTGCTCTCTCACCCGATGG - Intergenic
1203665334 Un_KI270754v1:17691-17713 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203665613 Un_KI270754v1:19101-19123 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203665896 Un_KI270754v1:20511-20533 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203666478 Un_KI270754v1:23327-23349 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203666762 Un_KI270754v1:24739-24761 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203667045 Un_KI270754v1:26150-26172 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203667627 Un_KI270754v1:28966-28988 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203667911 Un_KI270754v1:30378-30400 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203668193 Un_KI270754v1:31789-31811 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203668485 Un_KI270754v1:33198-33220 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203668774 Un_KI270754v1:34605-34627 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203669051 Un_KI270754v1:36015-36037 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1203669619 Un_KI270754v1:38831-38853 TGGGCTGCTCTCTCACCCGAGGG - Intergenic
1186913305 X:14193116-14193138 TGGGTTCCTCTGGCACCTGAAGG + Intergenic
1189795139 X:44638750-44638772 TTGGCTCCTCTTCTACCTGATGG - Intergenic
1192308671 X:69990287-69990309 TGGTCTCCTCTGACACCTGAAGG + Intronic
1193163469 X:78256395-78256417 GGGGGTCCTCTCCAACCTGAAGG - Intergenic
1193497841 X:82236548-82236570 TGGGTTTCTTTCCCCCTTGAGGG + Intergenic
1194072969 X:89350552-89350574 AAGGCTCCTCTCCCATTTGAGGG + Intergenic
1194405792 X:93494298-93494320 TGGGTTCCTCCCACACCTGAAGG - Intergenic
1197269914 X:124414215-124414237 TGGGAAGCCCTCCCACTTGAAGG - Intronic
1200727208 Y:6686292-6686314 AAGGCTCCTCTCCCATTTGAGGG + Intergenic
1200728360 Y:6702067-6702089 AAGGCTCCTCTCCCATTTGAGGG + Intergenic
1200851954 Y:7892352-7892374 TTGGGTCCTCTCCCACTGTAAGG - Intergenic
1201264607 Y:12193818-12193840 TAGACTCCTCTCCCACCTGGAGG - Intergenic