ID: 951168531

View in Genome Browser
Species Human (GRCh38)
Location 3:19510885-19510907
Sequence CCTCTGTGTCACAGGATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951168531 Original CRISPR CCTCTGTGTCACAGGATTAT TGG (reversed) Intronic
900236155 1:1592024-1592046 CTTCTGTGTCCCAGGAGTGTGGG - Intergenic
901782818 1:11605279-11605301 CCTGTGTGTCATAGGATGTTTGG + Intergenic
901928866 1:12584074-12584096 CCTATGTGTAACAGGACCATGGG + Intronic
902302739 1:15513891-15513913 CATCTGTATTACAGGATAATAGG + Intronic
904209701 1:28878827-28878849 CCTCTGGGTCACAGGTGTATAGG - Intergenic
904523327 1:31113077-31113099 CCTCTGCCTCCCAGGATTACAGG + Intergenic
904766532 1:32853065-32853087 CCTCTGTATCACAGGTATCTCGG + Exonic
906255255 1:44344113-44344135 CCCCTGAGTCACTGGATTACAGG - Intronic
907893960 1:58665971-58665993 CCTCTGTCTCCCAGGTTTAAGGG - Intronic
908337642 1:63143929-63143951 CCTCTTTGTCACATCATTAAAGG + Intergenic
911427983 1:97745547-97745569 CGTCTATGTCAGGGGATTATTGG + Intronic
919533880 1:198762004-198762026 GCTTTTTGTCACATGATTATTGG - Intergenic
920922725 1:210311558-210311580 CCTCCGTGTCAAAGGCTTCTCGG - Intergenic
921192247 1:212721110-212721132 CCTCTGGGTAAAGGGATTATTGG - Intergenic
922589253 1:226761373-226761395 CCTCTGTGTAGCAGGATTATTGG - Intergenic
924486076 1:244486004-244486026 CCTCTGGGTAAAAGGATTTTAGG - Intronic
1063301194 10:4850241-4850263 CCTCTGCGTCAAATGATTGTGGG + Intergenic
1073886070 10:108041192-108041214 GCCCTGTGTCACAGGAATAGAGG + Intergenic
1074107902 10:110402169-110402191 CCCCTACCTCACAGGATTATTGG - Intergenic
1074403012 10:113157374-113157396 CCTCAGAGTGCCAGGATTATAGG + Intronic
1076004298 10:126935716-126935738 CCTCTGATTCACAGGATGCTGGG - Intronic
1077375057 11:2201924-2201946 CCTCTGTTTCAGAGGAGTAGAGG - Intergenic
1077610238 11:3639478-3639500 CCTCTGTGACTCAGGTTTTTTGG - Intronic
1083541629 11:63515592-63515614 CCTGAGTGTCACAGGAGCATGGG - Exonic
1086116038 11:83251309-83251331 CATCTGTATCACAGCATGATTGG + Intronic
1086310578 11:85531848-85531870 CATCTTTCTCACAGGGTTATTGG - Intronic
1087210894 11:95445924-95445946 CCCCAGTGTCATAGGATTCTTGG + Intergenic
1088080069 11:105901286-105901308 ATTCTGTGACACAGGTTTATGGG - Intronic
1093855011 12:24091643-24091665 CCTCTGTCTCATCTGATTATGGG - Intergenic
1096944044 12:55384047-55384069 CCTCAGTGTGACGGGATTGTTGG - Intergenic
1100882769 12:99036938-99036960 GCTCTGTGTCACAGATTAATTGG + Intronic
1101531434 12:105576867-105576889 CTTCTGTGTAACTGGACTATAGG + Intergenic
1102747991 12:115266975-115266997 CTTCTGTGTCACTGGTTTCTAGG - Intergenic
1103392723 12:120585864-120585886 CCTGTGTCTCAGAGGATAATGGG - Intergenic
1105759755 13:23503183-23503205 CCTCTGTGGCACAGGCTTCCAGG - Intergenic
1105816638 13:24042130-24042152 CCTCTGTGTCACGGGAGCGTTGG + Intronic
1106295814 13:28412818-28412840 CCTCTGCCTCCCAGGATTACAGG + Intronic
1106594498 13:31124923-31124945 CATTTGTCTCACAGGATTGTTGG - Intergenic
1109375311 13:61485383-61485405 CCTCAGTGTCACAGGCTTTGGGG + Intergenic
1110209853 13:72958643-72958665 CCTCTTTGTCGCTGGATTACAGG - Intronic
1112346241 13:98592461-98592483 CCTCTGTGTCTCAGGACGTTTGG + Intergenic
1112349237 13:98619075-98619097 CCTCTGAGGCACAGGGTTAGTGG + Intergenic
1118320855 14:64752574-64752596 CATCAATGTCACAGGATTGTTGG + Intronic
1118903484 14:70005738-70005760 CATCTGAGGGACAGGATTATAGG + Intronic
1118944672 14:70373294-70373316 CATCAGTGTCACAGGATCTTTGG + Intronic
1119890567 14:78179172-78179194 CATCTGTGTCACAGGATAAAGGG + Intergenic
1121457590 14:94048540-94048562 CCTATGTGTCACTGGATTATTGG + Exonic
1125720524 15:41843034-41843056 CCTCACAGACACAGGATTATTGG + Intronic
1126793993 15:52245067-52245089 CCTCTGTGGACCAGGCTTATAGG - Intronic
1128053616 15:64683892-64683914 CCTCTGTGTTACAGAATGAGTGG - Exonic
1128284431 15:66424653-66424675 CCTTTGTGGCAAAGGATTAAGGG - Intronic
1131254018 15:90849795-90849817 CCTCTTTTTCATATGATTATTGG - Intergenic
1133708699 16:8380278-8380300 TATCTGTCTTACAGGATTATGGG - Intergenic
1135232799 16:20725565-20725587 CCTCGATGACACAGAATTATTGG - Intronic
1136993855 16:35174146-35174168 CCCCTGTCTCACAGGATTCCAGG + Intergenic
1138113319 16:54341212-54341234 ACTCTGGGTGAAAGGATTATAGG - Intergenic
1139483425 16:67243540-67243562 CCTATCTGTAAAAGGATTATTGG - Intronic
1140749132 16:78007502-78007524 CCTGTGTGACACAGCATTAGAGG - Intergenic
1143643897 17:8217121-8217143 CCTCTGCCTCCCAGGATTACAGG + Intergenic
1144209391 17:13001900-13001922 TCTCTGGGCAACAGGATTATGGG + Intronic
1144515445 17:15914548-15914570 GCTCTGGGGCACATGATTATTGG - Intergenic
1146500778 17:33362612-33362634 CATCTTTCTCACAGGATTCTTGG + Intronic
1147177470 17:38664840-38664862 CCTTTGTGTCACAGTTTTAAAGG - Intergenic
1152367940 17:79867831-79867853 TCTCTGTGTCATAAGATTATAGG - Intergenic
1156244282 18:35283349-35283371 CCACTGTGTCACAGGATACTTGG + Intronic
1156358999 18:36367467-36367489 CTTCTGGGTCACTGGATTCTGGG + Intronic
1158630534 18:59110304-59110326 CCTCTGTGTCCAGGGATAATGGG - Intergenic
1159772820 18:72567729-72567751 CATCTGTGTAACAGGAATTTTGG - Intronic
1161051657 19:2167093-2167115 CCTGTGGGTCACAGGACTGTGGG + Intronic
1163141654 19:15353237-15353259 CCTCTGCCTCCCAGGATTACAGG - Intergenic
1165048792 19:33127972-33127994 CCTCTGAGTGCCAGGATTACAGG + Intronic
1165757201 19:38300770-38300792 CCTCTGAGTCACACCATTCTGGG + Intronic
1167020589 19:46872319-46872341 ACTCTGTGTTGTAGGATTATGGG + Intergenic
925014261 2:509946-509968 CCACACGGTCACAGGATTATAGG - Intergenic
925184126 2:1835706-1835728 CCTGTGTGTCACAGGGCTCTGGG - Intronic
925319471 2:2951182-2951204 CCACTGTGTCCCAGGAGGATGGG - Intergenic
926144797 2:10390379-10390401 CGTCTGTGTGACAGTATTCTTGG + Intronic
928917580 2:36489513-36489535 TATCTCTGTCACAGGACTATGGG - Intronic
929882577 2:45849839-45849861 CCTCTGTGTCTTGGGATTTTTGG + Intronic
930436667 2:51352882-51352904 CTTCTTTTTCACAGAATTATAGG - Intergenic
931083881 2:58807482-58807504 ACACTGGGTCACAGGATTAGAGG - Intergenic
933763004 2:85686596-85686618 CCTCTTTGTTACATGATTTTAGG - Intronic
937625183 2:124035824-124035846 ACTCTGTGACACAGGAATACTGG - Intronic
939017478 2:136919593-136919615 TCTCTCTGTCACAGGATATTTGG + Intronic
941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG + Intronic
942164885 2:173232178-173232200 CCTCTCTTTCACAGTATTGTTGG + Exonic
942820596 2:180109537-180109559 CCTCTTTGTCATAAGAATATGGG - Intergenic
943192717 2:184700399-184700421 CCTCTGTATTACAGGAATCTAGG + Intronic
943746613 2:191468852-191468874 CCTCCGTGTGACAGAATTCTGGG - Intergenic
946324688 2:218979181-218979203 CGTCTGTGTAACAGGACTATAGG + Intergenic
948780882 2:240320858-240320880 CTTCTGTGTCACAGGACTGCAGG - Intergenic
1169181575 20:3573681-3573703 GCTCTATGTCACAGCAATATAGG - Intronic
1169462535 20:5808194-5808216 CCTCTGTGTCCCAGGTTCAAGGG - Intronic
1172335051 20:34108913-34108935 TCTCTGTGTGATAGGATTGTGGG + Intronic
1173122836 20:40309412-40309434 ACTGTGTGTCACAGGAAAATGGG + Intergenic
1173524400 20:43720976-43720998 CCTCTGTGTCATACTGTTATGGG + Intergenic
1175001194 20:55632521-55632543 TCCCTGTGTTACAGGATTTTTGG + Intergenic
1177687422 21:24456424-24456446 TGTCTGTGTCACAGGAATCTTGG + Intergenic
1178463556 21:32825712-32825734 CCTCTGGGTCTCAGGCTTTTGGG - Intergenic
1179218414 21:39386374-39386396 CTTCTGAGTCACAGGATTCTGGG - Intronic
1181993616 22:26857457-26857479 CCTCTGTAGCACAGGATCAGAGG + Intergenic
1182268048 22:29134861-29134883 CCTCTGTGGCACAGGCATGTGGG - Intronic
1185028915 22:48431615-48431637 CCTCTGTCTCCCAGGACTCTCGG + Intergenic
1185164805 22:49255038-49255060 TCTCTGTAACACATGATTATAGG + Intergenic
951168531 3:19510885-19510907 CCTCTGTGTCACAGGATTATTGG - Intronic
952573468 3:34745552-34745574 CATTTGTGTCACAGGTATATGGG + Intergenic
954793928 3:53151897-53151919 CCTCTGTGTCAGAGGAAAACAGG + Intergenic
957138419 3:76319927-76319949 ACTCTGTATCCCAGGATTAGAGG + Intronic
961332502 3:126151015-126151037 CCTCTGTGTCCCTGGAATAGTGG - Intronic
962211778 3:133485817-133485839 CTTGTGTGTCACAGGATCCTTGG + Intergenic
967605469 3:191440303-191440325 CCTTTTTGTCACATGATTGTTGG - Intergenic
970857495 4:20665971-20665993 TGTCTGTGTCACAGGACCATAGG + Intergenic
974354387 4:60793731-60793753 CCTATTTGTCACAGGATATTGGG - Intergenic
974837103 4:67264365-67264387 CCCCTGTGGCTCAGGTTTATGGG - Intergenic
975662540 4:76702022-76702044 CTACTGGGTGACAGGATTATGGG - Intronic
977183616 4:93909015-93909037 CTTCTGAGTGACAGGACTATTGG + Intergenic
981954206 4:150449562-150449584 CCTCTGTGGCACAGGCATAGAGG + Intronic
984290468 4:177787894-177787916 GCTCTGTTTATCAGGATTATTGG - Intronic
984814722 4:183825614-183825636 CCTCTGTGTCCCAGGACTCGCGG + Intergenic
995988893 5:118211571-118211593 CCTCTGGGTGACAGGATTATAGG - Intergenic
997288253 5:132699933-132699955 ACTCTGGGTCGTAGGATTATGGG - Intronic
998192587 5:140039895-140039917 CCTCTGGGCCACAGGGTCATTGG - Intronic
998816726 5:146021887-146021909 CCTCTGACTCACAAGGTTATTGG + Intronic
999217241 5:149945495-149945517 CCTCTGAGTAACAGGATTATGGG - Intergenic
999687776 5:154117855-154117877 TCTCTGTGTAACAGGATGTTGGG - Intronic
999935970 5:156486194-156486216 CCTGTGTGTCACAGTTTTCTGGG + Intronic
1005184118 6:23144277-23144299 CGTCTGTCTCACAGAATTCTGGG + Intergenic
1006554101 6:34851375-34851397 CCTCTGAGTCACAGCATTACTGG - Intronic
1009883115 6:69593931-69593953 CTTCTGAGTCACCGGCTTATTGG - Intergenic
1010179584 6:73070222-73070244 CATTTGTGTCACACGAATATAGG + Intronic
1010567328 6:77431880-77431902 CATCTGTGGCACAGGATTGTGGG - Intergenic
1014735144 6:125085239-125085261 CCACTTTGTAACAGGAATATTGG - Exonic
1015028043 6:128560997-128561019 ACTGTGTGTCACAAGATAATGGG - Intergenic
1015182298 6:130373363-130373385 CCTTTGGGTCATAGGATTACAGG - Intronic
1016506117 6:144781285-144781307 CCTCTGTGTCAGAGCATCATCGG + Intronic
1018325049 6:162657914-162657936 TCTCTGCCTCAGAGGATTATAGG + Intronic
1021363664 7:19749022-19749044 TCTCTGAGTGGCAGGATTATTGG + Intronic
1023081753 7:36532951-36532973 TCTCTGTGGCACTGGATTATGGG + Intronic
1023189463 7:37563991-37564013 CCTCTGGGTAAAAGGACTATGGG - Intergenic
1023742869 7:43296256-43296278 TCTCTGTGTTACATAATTATGGG + Intronic
1024189757 7:46994043-46994065 CATTTATGTCATAGGATTATGGG + Intergenic
1028624341 7:92861776-92861798 CTCCTGTGTCACAGGACTGTAGG - Intergenic
1031540123 7:122985341-122985363 CTTCTGTGTCACACAATTTTTGG - Intergenic
1032166065 7:129545942-129545964 CCTCTGGGTGGCAGGATTATAGG - Intergenic
1032198019 7:129800408-129800430 CCTCTGCTGCCCAGGATTATAGG + Intergenic
1034887419 7:154808598-154808620 TCTCTGTGTCACTGGCTCATTGG - Intronic
1035587642 8:787980-788002 GCTCTGTGGCTCAGGATTCTAGG + Intergenic
1035754723 8:2022773-2022795 CCTCTGTTTCAAGGGTTTATGGG - Intergenic
1038151997 8:24950370-24950392 CCCATCTGTCACAGGATTTTTGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1041702839 8:60810665-60810687 CTTCTTTGTCACAGAAATATGGG - Intronic
1045846127 8:106638484-106638506 CCTCTGTATCACTGGATTTGAGG + Intronic
1047413949 8:124648663-124648685 CCTCTCAGGCTCAGGATTATAGG + Intronic
1048485604 8:134844617-134844639 CCTCTGTGTGACAGGGTATTAGG - Intergenic
1053416216 9:37948465-37948487 CCTCTGTATCCCAGGAGAATAGG + Intronic
1053468522 9:38328064-38328086 CCTTTGTGTCCCAGGCTTACTGG + Intergenic
1057809357 9:98245942-98245964 CCTCTGGGTGATAGGATTACAGG + Intronic
1059541563 9:115135538-115135560 CTTCTGAGTCACAGGAGTACAGG - Intergenic
1060024668 9:120161158-120161180 CCTCTGTGTCGTGGGATCATGGG - Intergenic
1188087285 X:25915130-25915152 TGTCTGTGTCACCAGATTATAGG - Intergenic
1189038094 X:37513427-37513449 CCTCTGTGTCACAGAGCCATTGG - Intronic
1191884976 X:65878976-65878998 GGTCTGTGTCACAGGATTTATGG + Intergenic
1192063056 X:67850738-67850760 CCTCTGGCTCACAGCATTTTTGG + Intergenic
1194212357 X:91083585-91083607 ACACTGTGTCACAGGATCCTTGG - Intergenic
1198594621 X:138222978-138223000 CCTCTGTGCCAGAGGGTTAAAGG - Intergenic