ID: 951170245

View in Genome Browser
Species Human (GRCh38)
Location 3:19533524-19533546
Sequence GTCTGTAAGCTCTCCCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951170245_951170256 30 Left 951170245 3:19533524-19533546 CCCTCCAGGGAGAGCTTACAGAC 0: 1
1: 0
2: 1
3: 17
4: 139
Right 951170256 3:19533577-19533599 CCTACACTTGCAAACAGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 66
951170245_951170254 29 Left 951170245 3:19533524-19533546 CCCTCCAGGGAGAGCTTACAGAC 0: 1
1: 0
2: 1
3: 17
4: 139
Right 951170254 3:19533576-19533598 GCCTACACTTGCAAACAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 83
951170245_951170252 25 Left 951170245 3:19533524-19533546 CCCTCCAGGGAGAGCTTACAGAC 0: 1
1: 0
2: 1
3: 17
4: 139
Right 951170252 3:19533572-19533594 CCTTGCCTACACTTGCAAACAGG 0: 1
1: 0
2: 0
3: 3
4: 100
951170245_951170253 28 Left 951170245 3:19533524-19533546 CCCTCCAGGGAGAGCTTACAGAC 0: 1
1: 0
2: 1
3: 17
4: 139
Right 951170253 3:19533575-19533597 TGCCTACACTTGCAAACAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 94
951170245_951170248 -10 Left 951170245 3:19533524-19533546 CCCTCCAGGGAGAGCTTACAGAC 0: 1
1: 0
2: 1
3: 17
4: 139
Right 951170248 3:19533537-19533559 GCTTACAGACCAGAACGAGCTGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951170245 Original CRISPR GTCTGTAAGCTCTCCCTGGA GGG (reversed) Exonic
900633299 1:3649941-3649963 CTCTGCAAGTTCTCCCCGGACGG - Exonic
903094968 1:20963088-20963110 GTCTGTATGGTCTCTCTGTATGG + Intronic
903237105 1:21957159-21957181 GGCGGGAAGCTCTCCCTGGCAGG - Intergenic
904009655 1:27382559-27382581 GTCTGTGAGCACTGCGTGGAGGG - Exonic
904987749 1:34565886-34565908 GCATGTAAGCTCTCTCAGGAAGG - Intergenic
907752648 1:57277940-57277962 GTCTTTCAGCTTTCCCTGGCTGG - Intronic
909340091 1:74522026-74522048 GTCTGTCATCTATCACTGGAAGG - Intronic
910126765 1:83851104-83851126 GATAGTAAGTTCTCCCTGGATGG - Intergenic
915435744 1:155904488-155904510 GGCTGTAAACTCTGCCTAGAGGG + Exonic
915718328 1:157965076-157965098 ATCTGTAGGGTCTTCCTGGAAGG + Intergenic
917386385 1:174480564-174480586 TTCTTTATGCTATCCCTGGATGG + Intronic
921711305 1:218376342-218376364 CACTTTAAGCTCTGCCTGGATGG + Intronic
922080844 1:222294431-222294453 GTGTGCAAGCTCCTCCTGGAAGG - Intergenic
922117335 1:222626935-222626957 GTCTTTCAGCTCCTCCTGGATGG + Intronic
923162420 1:231327145-231327167 ATCTGTGAGCCCTCACTGGAGGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1065017940 10:21478759-21478781 TTCTGTGAGCTCTCCCGGTAAGG + Intergenic
1066009519 10:31181504-31181526 GGCTGCAAGCTGTCCCTGGAAGG + Intergenic
1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG + Intergenic
1070786653 10:79165996-79166018 GTGTGTGGGCTCTCCCTGCAGGG + Intronic
1072433955 10:95398571-95398593 TTCAGGAAGATCTCCCTGGATGG - Intronic
1073128372 10:101167572-101167594 GTCTGTAATCTCGCCTTGGGAGG - Intergenic
1076631086 10:131852867-131852889 AGCTGCAAGGTCTCCCTGGAGGG - Intergenic
1080313497 11:30922178-30922200 ATCTGAAAGCTCTCCCTAAAGGG + Intronic
1080901633 11:36498792-36498814 GTTTGTAAGCTCTCCATAAAAGG - Intronic
1081465343 11:43311791-43311813 GGCTGCAGGCTCTCCATGGAAGG - Intergenic
1081753478 11:45528566-45528588 TTGTGTAAGCTGTCCCAGGAAGG - Intergenic
1083011045 11:59399807-59399829 GACTCTAAGCTCTCCCTTGAGGG + Intergenic
1085252330 11:75152101-75152123 GTCTTGAAGCTCTGCCTGCAGGG + Intronic
1086521180 11:87669543-87669565 GTCTGCAAGCTTTCCCTGGATGG + Intergenic
1088320702 11:108552098-108552120 GTTTTAAAGCTTTCCCTGGAGGG - Intronic
1093997693 12:25659677-25659699 GTCTGTAAGTTCTCCAAGGTTGG - Intergenic
1100831055 12:98516569-98516591 GTCTCAGAGCGCTCCCTGGAGGG + Intronic
1102831308 12:116003328-116003350 GTCTGCAAGCTCTCCTTTGATGG - Intronic
1106456649 13:29933834-29933856 GTCTGGTAGTTCTCCCTGGGAGG + Intergenic
1107295068 13:38899454-38899476 GTTTTTTAGCTGTCCCTGGAGGG - Intergenic
1108553255 13:51567509-51567531 GTCAGGAAGCTCGCACTGGATGG + Intergenic
1112170221 13:96964646-96964668 GTCTTCAAGCTCTTCCTGTAAGG + Intergenic
1115964872 14:38876984-38877006 GTCTGTAAGATCTCCATGTTGGG - Intergenic
1117458940 14:55925877-55925899 GTCTGTAAACTCTCCCTCACTGG + Intergenic
1118386558 14:65260370-65260392 GTCTAGAAACTCTCCCTGAAGGG + Intergenic
1202863207 14_GL000225v1_random:97691-97713 TTTTCTAAGCTCTGCCTGGAGGG + Intergenic
1124056535 15:26245317-26245339 ATCTGTCGGCTCTTCCTGGAAGG + Intergenic
1125505864 15:40267217-40267239 GTCTTAAAGCCCTCCCAGGAGGG - Intronic
1128436101 15:67650402-67650424 GACTGAAAGCTCTCCCTCTAAGG - Intronic
1130122173 15:81060578-81060600 GTCTGTTGGCCCTCCCTGTATGG + Intronic
1131352828 15:91717337-91717359 GTCTGAAGGCTCTCCCTGCCTGG + Intergenic
1131842976 15:96457860-96457882 GTGTATACACTCTCCCTGGATGG + Intergenic
1133764704 16:8829854-8829876 GTCTGGAAACTCTTTCTGGAAGG - Intronic
1137890904 16:52161182-52161204 GTCTGTTGGCCCTCCCTGGGAGG + Intergenic
1140351011 16:74261940-74261962 GTCTCTCAGCTTTCCCTTGATGG + Intergenic
1158137985 18:54226479-54226501 GTAAGTAAGCTCTCCAAGGAAGG + Intergenic
1160253308 18:77223302-77223324 GTCTCTAAGGACTTCCTGGAAGG - Intergenic
1163026457 19:14515672-14515694 GTCTGGCAGCCCTCCCGGGATGG - Exonic
1165105014 19:33464122-33464144 GGCCCTGAGCTCTCCCTGGAGGG - Intronic
1165988018 19:39787546-39787568 GTCTACAGACTCTCCCTGGAAGG + Intergenic
1166882614 19:45938621-45938643 GTCTGCGAACTCGCCCTGGAGGG - Exonic
1167103418 19:47417552-47417574 GTCAGGAATCTCTGCCTGGACGG - Intronic
925093610 2:1175791-1175813 GACTCTAAACTCTTCCTGGAAGG + Intronic
926012485 2:9419824-9419846 GGCTCTAAGCTCTCCCTCAAGGG + Intronic
927640488 2:24842502-24842524 ATCTGTGAGGTCTCTCTGGAGGG - Intronic
928114959 2:28539950-28539972 GGAGGGAAGCTCTCCCTGGAGGG - Intronic
928212010 2:29330340-29330362 GTCTGTGAGCTGGACCTGGACGG - Intronic
932337277 2:70938406-70938428 GTCTGTAAGCACTCCCAGACAGG + Intronic
934505495 2:94889366-94889388 GTCTGTAAGCCCTCAATGAACGG + Intergenic
936937705 2:117854010-117854032 GTCTCTCAGCTTTCCCTGGCAGG - Intergenic
936937717 2:117854062-117854084 GTCTCTCAGCTTTCCCTGGCAGG - Intergenic
938094062 2:128450295-128450317 TGCTGTATGCTCTCGCTGGATGG + Intergenic
939858621 2:147391200-147391222 GTCTGTAAGATCTCCCATGGGGG + Intergenic
940051845 2:149473247-149473269 GTCTGCAAGCACTCCCTGGGTGG - Exonic
941230924 2:162912085-162912107 GTATGCAAGCTCCTCCTGGAAGG - Intergenic
943554743 2:189388364-189388386 GTCTGTTCCCTCTGCCTGGAAGG - Intergenic
946178488 2:217936388-217936410 GCCTGAAAGATCTCCCAGGAAGG + Intronic
1174208646 20:48859436-48859458 GTCTGGAAGTTCTTCCTGAAGGG - Intergenic
1175299378 20:57932216-57932238 GGCTGTGGGCGCTCCCTGGAGGG - Intergenic
1177941482 21:27416980-27417002 GTCTGAAAGCTGGCCCTGAAGGG + Intergenic
1179902115 21:44399743-44399765 GTCTGCCCTCTCTCCCTGGAGGG + Intronic
1181042576 22:20199197-20199219 GTCTGCAAGATGTCCCAGGATGG + Intergenic
1181504621 22:23344040-23344062 CTCTGTAATCTCTGCCTGGGGGG + Intergenic
1181655736 22:24296653-24296675 CTCTGTAATCTCTGCCTGGGGGG + Intronic
1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG + Intergenic
1184987936 22:48148036-48148058 GTCTGTCCGCTCTCCCTGCTGGG - Intergenic
951170245 3:19533524-19533546 GTCTGTAAGCTCTCCCTGGAGGG - Exonic
951405250 3:22289369-22289391 GTCTGTAGATTCTCTCTGGAAGG - Intronic
952036691 3:29211390-29211412 GGCTGTGAGCTCTCCTGGGAAGG - Intergenic
954686398 3:52372493-52372515 GGCTGTCAGCTCCCCCTGGGAGG - Intronic
955375048 3:58387686-58387708 GACTGTATGCTCTGGCTGGAAGG - Intronic
955577191 3:60378416-60378438 GTTTGTAAGCTCTATCTGCAAGG - Intronic
955990110 3:64617488-64617510 CTTTGTAGTCTCTCCCTGGATGG + Intronic
957223273 3:77411714-77411736 GTGTGTAAACTCTATCTGGAAGG + Intronic
959989302 3:112612933-112612955 TTCTGGTAGCTCTTCCTGGATGG + Intronic
961614242 3:128166233-128166255 GTCTGTCAGCCCTCTCTGCAAGG - Intronic
963581338 3:147129815-147129837 GCCTGGAAGCTCTACCTGGGTGG - Intergenic
965567489 3:170135801-170135823 GACAGTAAGCTCACTCTGGATGG + Intronic
968818480 4:2833697-2833719 GACTCTAAGTTCTACCTGGAGGG + Exonic
968955005 4:3713824-3713846 GTCTGTGAGGTGCCCCTGGACGG - Intergenic
977798455 4:101196685-101196707 GTGTGTATGCTCTCACTGAAGGG + Intronic
977992253 4:103458574-103458596 GTCTGCAAGCTCTGCCTCCAGGG + Intergenic
978431136 4:108634515-108634537 GTCTGTCAGCCCTCACTGGAAGG - Intergenic
984219222 4:176952994-176953016 GTCTGTCAGCTCTCTTTGGTAGG + Intergenic
985631255 5:1015229-1015251 GTCAGCAAGCTCTCACTGGTTGG + Intronic
992192974 5:74312297-74312319 GGTTTTGAGCTCTCCCTGGAGGG - Intergenic
992671096 5:79062038-79062060 GGGTGTAAGCCCTCCCTCGAAGG + Intronic
994808042 5:104477744-104477766 GGCTATAATTTCTCCCTGGAAGG - Intergenic
995018578 5:107341623-107341645 CTCTGTGAGCCCTCTCTGGATGG + Intergenic
995397027 5:111697929-111697951 TTCTGTTAAATCTCCCTGGAAGG + Intronic
997212981 5:132088384-132088406 GGATGTAAGCTGCCCCTGGAAGG + Intergenic
997296227 5:132770604-132770626 GTCTGTAAGCTGGCTCTGGTGGG + Intronic
999354438 5:150911420-150911442 GTCTGCAGACTCTCCCTGAAGGG + Intergenic
1002698435 5:181105457-181105479 GTCTGCAAGCTTTCTCTGCAAGG + Intergenic
1002708465 5:181179451-181179473 GTCTGCAAGCTTTCTCTGCAAGG - Intergenic
1003529394 6:6925310-6925332 GTCTGTAAGCTCTTCTGGGCAGG - Intergenic
1003568898 6:7243062-7243084 GTGTTTAAGCTCTCCCTTAATGG + Intronic
1004429617 6:15531944-15531966 TTCTTTAACCTCTCCTTGGAGGG + Intronic
1006314425 6:33281739-33281761 CTCTGTGTGCTTTCCCTGGAAGG + Intronic
1010167308 6:72931832-72931854 ATCTGGAAGCTCTCTCTGGCAGG - Intronic
1015183124 6:130382379-130382401 AGCTGTTAGCTCTGCCTGGATGG + Intronic
1018253434 6:161895330-161895352 TTCTGTGAGCCCTCCATGGAAGG - Intronic
1018973494 6:168545698-168545720 GTCTGAAAGCTCAGCCTGAATGG - Intronic
1019275168 7:172379-172401 CTCTGTAAGCTCCCTCTGGAGGG + Intergenic
1023777103 7:43618212-43618234 GCCATTAAGCCCTCCCTGGAAGG + Intronic
1026062263 7:67036948-67036970 GTCTGGCAGCCCTCCCAGGATGG - Intronic
1026716083 7:72790501-72790523 GTCTGGCAGCCCTCCCAGGATGG + Intronic
1029178357 7:98681642-98681664 ATCTTTAAGCACTTCCTGGATGG + Intergenic
1030058781 7:105606832-105606854 TTGTGGAAGCTCTCCCTGGGGGG + Exonic
1033788327 7:144760887-144760909 TTCTTTAAGCTGACCCTGGAAGG - Intronic
1034863821 7:154623437-154623459 GTCTTTCAGCTCACCCTGGTGGG - Intronic
1035851657 8:2925337-2925359 GTGTTGAAGCTCTTCCTGGAGGG + Intergenic
1036600984 8:10259901-10259923 CTCTGTAGGCTCTCCCTGGTGGG + Intronic
1037070046 8:14633733-14633755 TTCTGTAAGCTCTACCTGCCTGG - Intronic
1039280768 8:35981385-35981407 GGATGTAAGCTTACCCTGGAGGG + Intergenic
1045470969 8:102511746-102511768 CTCTGTTTGCTCTCCCTGCAGGG - Intergenic
1045548189 8:103146988-103147010 GTCTGTGAGCTCTTCCAGGTTGG + Intronic
1046439270 8:114236941-114236963 GTCTGCAGGCTCTCCCTAGCAGG + Intergenic
1047023321 8:120800388-120800410 GTCTTTAATCTCTCACTGGATGG - Intronic
1047165675 8:122435796-122435818 GGCTGTAAGTTTTCCCTGAAAGG - Intergenic
1049326838 8:142025973-142025995 CTCTGCAATCTCTCCCTGGGAGG + Intergenic
1053303122 9:36965715-36965737 GTCTGTAGGGTCTCTCTGGTTGG + Intronic
1053343754 9:37362604-37362626 GTCAGTGACCTCTCCCTGCAAGG - Intergenic
1056964697 9:91155919-91155941 GTTTGTTCCCTCTCCCTGGAAGG - Intergenic
1057333032 9:94133783-94133805 GTCTGGAAGCTCTCTCCGGGTGG - Intergenic
1058457851 9:105154896-105154918 GTCTGCAAGCTCTTCCAGGCAGG + Intergenic
1059060646 9:111032429-111032451 GTGTGTAAGCTCCTCCTGGAGGG + Intronic
1060273445 9:122164461-122164483 GGCTGTAAGCCATCTCTGGACGG - Intronic
1060277743 9:122194678-122194700 GACTGTAAGCTCTCAATGCAGGG - Intronic
1186962071 X:14747226-14747248 AACTGTAAGCTTTCCCTGGAGGG - Intergenic
1189571432 X:42302001-42302023 GTCTGTGTGGTCTCCCTGCATGG - Intergenic
1190591204 X:52003619-52003641 GTCTGCAAATTCTCCCTAGAAGG - Intergenic
1192751651 X:73998369-73998391 CCTTGTAATCTCTCCCTGGAAGG + Intergenic
1196968748 X:121086192-121086214 GTCTGTAAGCTCTCACTTGTGGG - Intergenic
1200152311 X:153957265-153957287 GTCTGCAAGTCCTCACTGGAGGG - Intronic
1200875800 Y:8153504-8153526 GTCTGTAGACCCTCCCTGGAAGG + Intergenic
1202057252 Y:20848081-20848103 GTCTGTCAGCTCCTACTGGAAGG + Intergenic
1202103180 Y:21331866-21331888 TTGTGAAATCTCTCCCTGGAAGG - Intergenic
1202188997 Y:22221542-22221564 CTCTGAAATCTCTCCCCGGAAGG + Intergenic
1202239745 Y:22754320-22754342 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202392731 Y:24388082-24388104 CTCTGAAATCTCTCCCTGGAAGG - Intergenic
1202478052 Y:25282035-25282057 CTCTGAAATCTCTCCCTGGAAGG + Intergenic