ID: 951173789

View in Genome Browser
Species Human (GRCh38)
Location 3:19575516-19575538
Sequence TCCCAGTGGGTAATGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951173789_951173796 27 Left 951173789 3:19575516-19575538 CCTTTATTCATTACCCACTGGGA No data
Right 951173796 3:19575566-19575588 AATAATAATACTTCGTGACTAGG No data
951173789_951173794 -1 Left 951173789 3:19575516-19575538 CCTTTATTCATTACCCACTGGGA No data
Right 951173794 3:19575538-19575560 AGATGGTGGAGTCACTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951173789 Original CRISPR TCCCAGTGGGTAATGAATAA AGG (reversed) Intergenic
No off target data available for this crispr