ID: 951174220

View in Genome Browser
Species Human (GRCh38)
Location 3:19580188-19580210
Sequence CAACCTTCTCACATGGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951174220_951174228 21 Left 951174220 3:19580188-19580210 CCCATAGCCATGTGAGAAGGTTG No data
Right 951174228 3:19580232-19580254 TAAGCCTAAGGACAGCAGCTTGG No data
951174220_951174225 9 Left 951174220 3:19580188-19580210 CCCATAGCCATGTGAGAAGGTTG No data
Right 951174225 3:19580220-19580242 TTTTCCTCCACTTAAGCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951174220 Original CRISPR CAACCTTCTCACATGGCTAT GGG (reversed) Intergenic
No off target data available for this crispr