ID: 951174227

View in Genome Browser
Species Human (GRCh38)
Location 3:19580227-19580249
Sequence CTGCTGTCCTTAGGCTTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951174227_951174232 25 Left 951174227 3:19580227-19580249 CCACTTAAGCCTAAGGACAGCAG No data
Right 951174232 3:19580275-19580297 AAAGGCAGATGCTTAGTCAGAGG No data
951174227_951174230 7 Left 951174227 3:19580227-19580249 CCACTTAAGCCTAAGGACAGCAG No data
Right 951174230 3:19580257-19580279 GACACCTGATTGCAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951174227 Original CRISPR CTGCTGTCCTTAGGCTTAAG TGG (reversed) Intergenic
No off target data available for this crispr