ID: 951174228

View in Genome Browser
Species Human (GRCh38)
Location 3:19580232-19580254
Sequence TAAGCCTAAGGACAGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951174220_951174228 21 Left 951174220 3:19580188-19580210 CCCATAGCCATGTGAGAAGGTTG No data
Right 951174228 3:19580232-19580254 TAAGCCTAAGGACAGCAGCTTGG No data
951174224_951174228 14 Left 951174224 3:19580195-19580217 CCATGTGAGAAGGTTGGGAGACA No data
Right 951174228 3:19580232-19580254 TAAGCCTAAGGACAGCAGCTTGG No data
951174221_951174228 20 Left 951174221 3:19580189-19580211 CCATAGCCATGTGAGAAGGTTGG No data
Right 951174228 3:19580232-19580254 TAAGCCTAAGGACAGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951174228 Original CRISPR TAAGCCTAAGGACAGCAGCT TGG Intergenic
No off target data available for this crispr