ID: 951179457

View in Genome Browser
Species Human (GRCh38)
Location 3:19641933-19641955
Sequence AAGAACAAAGAGAAGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951179448_951179457 13 Left 951179448 3:19641897-19641919 CCCCTCCAGGATTAGAGAGAAAG No data
Right 951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG No data
951179452_951179457 8 Left 951179452 3:19641902-19641924 CCAGGATTAGAGAGAAAGGAACA No data
Right 951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG No data
951179451_951179457 11 Left 951179451 3:19641899-19641921 CCTCCAGGATTAGAGAGAAAGGA No data
Right 951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG No data
951179449_951179457 12 Left 951179449 3:19641898-19641920 CCCTCCAGGATTAGAGAGAAAGG No data
Right 951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951179457 Original CRISPR AAGAACAAAGAGAAGAGGTG GGG Intergenic
No off target data available for this crispr