ID: 951184066

View in Genome Browser
Species Human (GRCh38)
Location 3:19691635-19691657
Sequence AGCTCGATAAATAGTGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951184064_951184066 1 Left 951184064 3:19691611-19691633 CCAAGAAGAGAGAAAATTCAAAT No data
Right 951184066 3:19691635-19691657 AGCTCGATAAATAGTGAAACGGG No data
951184063_951184066 17 Left 951184063 3:19691595-19691617 CCATTAGCAGGATTAACCAAGAA No data
Right 951184066 3:19691635-19691657 AGCTCGATAAATAGTGAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951184066 Original CRISPR AGCTCGATAAATAGTGAAAC GGG Intergenic