ID: 951187212

View in Genome Browser
Species Human (GRCh38)
Location 3:19727649-19727671
Sequence ATGTCCTTGTGGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951187212_951187215 17 Left 951187212 3:19727649-19727671 CCTTCACTCTTCCACAAGGACAT No data
Right 951187215 3:19727689-19727711 TTCCATGATTTAGAATAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951187212 Original CRISPR ATGTCCTTGTGGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr