ID: 951187487

View in Genome Browser
Species Human (GRCh38)
Location 3:19730606-19730628
Sequence GTTTGTTTTCCTATAACGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951187487_951187492 29 Left 951187487 3:19730606-19730628 CCAGTCGTTATAGGAAAACAAAC No data
Right 951187492 3:19730658-19730680 ACTGATGGGTAAGACCTGAGAGG No data
951187487_951187491 15 Left 951187487 3:19730606-19730628 CCAGTCGTTATAGGAAAACAAAC No data
Right 951187491 3:19730644-19730666 CCATTCTGTTAACAACTGATGGG No data
951187487_951187489 14 Left 951187487 3:19730606-19730628 CCAGTCGTTATAGGAAAACAAAC No data
Right 951187489 3:19730643-19730665 GCCATTCTGTTAACAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951187487 Original CRISPR GTTTGTTTTCCTATAACGAC TGG (reversed) Intergenic
No off target data available for this crispr