ID: 951195339

View in Genome Browser
Species Human (GRCh38)
Location 3:19817373-19817395
Sequence GGCCTCAGGGGATCGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951195333_951195339 -5 Left 951195333 3:19817355-19817377 CCTGGTATCTCCTCAGAAGGCCT No data
Right 951195339 3:19817373-19817395 GGCCTCAGGGGATCGAGGCCTGG No data
951195331_951195339 4 Left 951195331 3:19817346-19817368 CCTAGTTAGCCTGGTATCTCCTC No data
Right 951195339 3:19817373-19817395 GGCCTCAGGGGATCGAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951195339 Original CRISPR GGCCTCAGGGGATCGAGGCC TGG Intergenic