ID: 951203806

View in Genome Browser
Species Human (GRCh38)
Location 3:19904209-19904231
Sequence AACCACATGAAACTAATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951203806_951203807 5 Left 951203806 3:19904209-19904231 CCATGCATTAGTTTCATGTGGTT 0: 1
1: 0
2: 1
3: 26
4: 282
Right 951203807 3:19904237-19904259 AAGAAATTACCAAAAACTGATGG 0: 1
1: 0
2: 9
3: 113
4: 858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951203806 Original CRISPR AACCACATGAAACTAATGCA TGG (reversed) Intronic
903023124 1:20408368-20408390 ATCCTCAGCAAACTAATGCAGGG + Intergenic
903863691 1:26381863-26381885 AACCTATTGAAACTAATGCAAGG + Intergenic
907567500 1:55449645-55449667 AGCCACTGGAAACTAATACAAGG + Intergenic
909100936 1:71347473-71347495 AACCACAAGAAAATAAAACAAGG - Intergenic
909291973 1:73894598-73894620 ACATACATGAAAATAATGCAGGG + Intergenic
909491489 1:76231826-76231848 ATCCACAAGAATCTAAAGCAGGG - Intronic
909521090 1:76568548-76568570 GACTACATTAAACCAATGCATGG + Intronic
910145355 1:84073974-84073996 CACCACAGGAAACTAAGTCAAGG + Intergenic
910159345 1:84256783-84256805 AACCCTAGAAAACTAATGCATGG + Intergenic
910880151 1:91915883-91915905 AGCCATAGGAAACTAATACAGGG - Intergenic
911459986 1:98177442-98177464 AACAACATGATACCATTGCATGG + Intergenic
911512814 1:98828008-98828030 AACCACAGCACACTAGTGCAAGG - Intergenic
913213557 1:116601289-116601311 AACCACATGTAACTGATTCCAGG + Intronic
913479468 1:119273679-119273701 AAGCAGGTGAAACTAATGTATGG + Intergenic
913713990 1:121515475-121515497 ATCCTCAGCAAACTAATGCAGGG + Intergenic
914005891 1:143732014-143732036 TACCCCATAAAACTAATGAAAGG - Intergenic
914044859 1:144082832-144082854 AGCAACAGGAAACCAATGCAAGG - Intergenic
914133251 1:144877854-144877876 AGCAACAGGAAACCAATGCAAGG + Intergenic
914330733 1:146668265-146668287 AACCACATGAAAACAATTCCTGG + Intergenic
916953796 1:169810322-169810344 AACCCCAGGAAATTAATACAAGG - Intronic
917202954 1:172536607-172536629 AGGCATAAGAAACTAATGCAGGG - Intronic
917635253 1:176929605-176929627 AGCCACAGAAAACTAATACAGGG + Intronic
919180360 1:194072614-194072636 AACCAGAAGAAACAAAAGCATGG - Intergenic
920959248 1:210649850-210649872 AACCACAAGGCACTTATGCAAGG + Intronic
921596545 1:217060175-217060197 ATCCACATGAATACAATGCATGG - Intronic
923812436 1:237334116-237334138 AACCACAAAAAACAAAGGCATGG - Intronic
923860490 1:237887794-237887816 TAACACATGAAACTGAAGCAAGG - Intronic
923953888 1:238992878-238992900 AAATACATGAAACTAATGAATGG + Intergenic
924207630 1:241729786-241729808 AAGCACAAGGAACTAAAGCAAGG - Intronic
1064326620 10:14357275-14357297 AACCATGAGAAACCAATGCAAGG - Intronic
1066430156 10:35343714-35343736 GGCTAGATGAAACTAATGCAAGG + Intronic
1066669365 10:37820621-37820643 AACCACATGAAACTAGCCAAGGG - Intronic
1066956983 10:42182514-42182536 AGCAACAGGAAACCAATGCAAGG - Intergenic
1067466991 10:46508360-46508382 AGCCACATAAAACAAATGCATGG - Intergenic
1067620195 10:47876245-47876267 AGCCACATAAAACAAATGCATGG + Intergenic
1067981036 10:51084636-51084658 AATCACATAAAAATAATGTAAGG - Intronic
1068417673 10:56745226-56745248 ATCAACACGAAAATAATGCAAGG + Intergenic
1070012472 10:72489955-72489977 CACCACATGAAACCAATGATTGG + Intronic
1071591099 10:86874134-86874156 AACCACATGAAACAATGGGATGG + Intronic
1071908940 10:90208495-90208517 AACCCCATGAACCCCATGCAAGG - Intergenic
1073791640 10:106946267-106946289 AACCAAATGAAAATAAGACATGG + Intronic
1074431561 10:113399172-113399194 AACCAGATGATGCTAATGAATGG - Intergenic
1076072653 10:127503814-127503836 AGCCCCAGCAAACTAATGCAGGG - Intergenic
1076289699 10:129335530-129335552 AAACACATGAAGCCAATGAAAGG + Intergenic
1077780018 11:5317297-5317319 AGCCACTTGAAACTACTACAAGG - Intronic
1078870627 11:15341195-15341217 AACCACATGAAAAAAGTGAAAGG + Intergenic
1082221592 11:49645428-49645450 AGCCACAGAAAACTAATACAAGG - Intergenic
1083970955 11:66074904-66074926 AATAAAATTAAACTAATGCATGG - Intronic
1084413563 11:69017637-69017659 AGCCACAAGAAACTAATCCATGG + Intergenic
1086077889 11:82874160-82874182 AACCACCTGAAAGTAATCAAAGG - Intronic
1086362998 11:86078481-86078503 AACAAGAGGAAACTAATACAGGG + Intergenic
1086627445 11:88973730-88973752 AGCCACAGGAAACTAATACAAGG + Intronic
1088564554 11:111155040-111155062 AACCCTAGGAAATTAATGCAAGG - Intergenic
1089035532 11:115386203-115386225 AAGGACATGAGACTATTGCATGG + Intronic
1089087325 11:115832896-115832918 AACCAAATGAAATTTATTCAAGG + Intergenic
1089300337 11:117495033-117495055 AGCCACTGGAAACTAACGCAGGG + Intronic
1092129322 12:6097735-6097757 AGCCACAGGAAACTGATACATGG + Intronic
1094348091 12:29493703-29493725 AACCACAAGAAACTATTAGATGG - Intronic
1095810138 12:46365472-46365494 AAAGACTTGATACTAATGCAGGG + Intronic
1096267678 12:50136737-50136759 AACCACAAGGACCTAATGGAAGG + Intronic
1097990798 12:65830997-65831019 AACTATATGAAACTGATTCAGGG - Intronic
1098591417 12:72218474-72218496 AACCTTAAGAAACTAATACATGG - Intronic
1098612000 12:72470200-72470222 AATCACAAGAAAATAAAGCAAGG - Intronic
1099064242 12:77953857-77953879 AGCCACAGGAAACTAATACAAGG - Intronic
1099604871 12:84791018-84791040 AATCACATGAAAATAATTGAGGG + Intergenic
1099639741 12:85271461-85271483 AACCACATCATATTAAAGCATGG - Intergenic
1100127685 12:91449265-91449287 AAGCACATGAAAAAAATGCTTGG + Intergenic
1101394116 12:104328980-104329002 AACCAACTGAAACCAATGTAAGG - Intronic
1101702955 12:107192734-107192756 AATTACATGAAATTACTGCAAGG - Intergenic
1101884032 12:108646162-108646184 AACCACATTAAGCTAAGACAAGG - Exonic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1103257233 12:119552335-119552357 AAGAGCATGAAACAAATGCAAGG + Intergenic
1103303676 12:119947406-119947428 AATCACATAAAACTCAAGCATGG + Intergenic
1105216792 13:18291845-18291867 AACCACATGTAACTGATTCCAGG + Intergenic
1106003123 13:25743418-25743440 AGCCCCAGGAAACTAATACAAGG + Intronic
1107390858 13:39962567-39962589 ATCCTCAGCAAACTAATGCAGGG - Intergenic
1109063571 13:57653027-57653049 AACCTCTTGAAACTACTGCCAGG - Intronic
1109523977 13:63551378-63551400 AACCACATAAAATTAAGTCAAGG + Intergenic
1109984046 13:69952247-69952269 AAACACATGAAAATAATCAATGG + Intronic
1110899105 13:80798332-80798354 AGCCACAGGAAAATAATACAGGG - Intergenic
1111226641 13:85282315-85282337 AACCACAAAACACTATTGCATGG + Intergenic
1111339475 13:86864260-86864282 AAACACATGAAAATAATACTAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114039801 14:18667135-18667157 AACCCAATGAAAGTAATGGAAGG + Intergenic
1115044713 14:28977411-28977433 AGCCACAGGAAACTAATACAGGG + Intergenic
1116162034 14:41280013-41280035 AAGCACATGAAATATATGCATGG + Intergenic
1116786413 14:49293636-49293658 AACAACGTGAATTTAATGCAAGG - Intergenic
1118104988 14:62648621-62648643 AGCTTCATGAAACTAATGCCAGG - Intergenic
1119331117 14:73794573-73794595 AGCCATAGAAAACTAATGCAGGG + Intergenic
1120626243 14:86830560-86830582 AAACAAATGAAACTAATGATTGG + Intergenic
1120946191 14:89999864-89999886 AGCAACAGAAAACTAATGCAAGG - Intronic
1202936127 14_KI270725v1_random:89262-89284 AGCAACAGGAAACCAATGCAAGG + Intergenic
1127393368 15:58524401-58524423 TACGAAATGAAATTAATGCAAGG - Intronic
1130418692 15:83719216-83719238 AAACACATTAAACTAAATCATGG + Intronic
1132060776 15:98690775-98690797 AACCACATGGAAAAAATGCCTGG - Intronic
1133006495 16:2884385-2884407 AGCAACAGGAAACTAATACAAGG - Intronic
1134137536 16:11688151-11688173 AACCACATGTAATTCATTCACGG + Intronic
1135050192 16:19186131-19186153 GTCCCCATGAAACTAAGGCACGG - Intronic
1137949223 16:52766857-52766879 AACCAAATGAAAGGAATGAAAGG + Intergenic
1138083067 16:54110076-54110098 AACCACTTGAAAGGGATGCAGGG - Intronic
1138604215 16:58077478-58077500 AACAACAACAAACTAATGGATGG + Intergenic
1140002819 16:71042640-71042662 AACCACATGAAAACAATTCCTGG - Intronic
1142059774 16:88021663-88021685 AAACAAATGAAATAAATGCATGG + Intronic
1143854770 17:9840491-9840513 AAGCACTTAAAAATAATGCATGG - Intronic
1144417194 17:15060757-15060779 AACCAGATGAAGATAATACAAGG + Intergenic
1144527025 17:15999398-15999420 AACCACATGGAAAAAAGGCAGGG + Exonic
1146232087 17:31121042-31121064 ATGCATATGAAACTAATACATGG - Intronic
1146930317 17:36772279-36772301 AAACACATAAAACTAATCTATGG - Intergenic
1147230894 17:39016992-39017014 AGCCACGTGAACCTAATCCATGG - Intergenic
1151232680 17:72695991-72696013 AGCCACAGGAGACTAATGCAGGG + Intronic
1152884901 17:82843897-82843919 CAACACATAAAACTAATCCATGG - Intronic
1156204976 18:34875483-34875505 AACCACATGTGACTATTGTAGGG + Intronic
1157644792 18:49256604-49256626 AACAATAGGAAACTAATACACGG + Intronic
1157961160 18:52154809-52154831 AACCACAGAAAACTAATAAAGGG - Intergenic
1157982431 18:52396818-52396840 AAACACATTAAACAAATGCCTGG + Intronic
1159146492 18:64460924-64460946 AAAAACATGAAACTCATACAAGG + Intergenic
1159425338 18:68277573-68277595 AAACAGATGAAACTAACTCATGG + Intergenic
1159637030 18:70817520-70817542 AACCATATGCAATTAATCCAAGG + Intergenic
1160164973 18:76502868-76502890 AACCAAATGAAACATTTGCATGG - Intergenic
1164632696 19:29772025-29772047 GACCACAGGAAAATAATCCAGGG + Intergenic
1164737891 19:30555300-30555322 ATCCACGTGAAACTGTTGCAAGG + Intronic
1165778581 19:38419189-38419211 AAGCACATGAAACTGATCCTTGG + Intronic
1202684417 1_KI270712v1_random:36236-36258 AGCAACAGGAAACCAATGCAAGG - Intergenic
926063263 2:9817979-9818001 AAGCAAACAAAACTAATGCATGG + Intergenic
926692275 2:15745793-15745815 AAACTCATGCAACTAGTGCAGGG + Intergenic
928246711 2:29635979-29636001 GGCCACACGAAACTAATACAAGG + Intronic
928859832 2:35844282-35844304 AACCAAATGAAAATATTGCAAGG + Intergenic
929023951 2:37581094-37581116 AACCAAATGAAACAAATGTCAGG - Intergenic
929694856 2:44105835-44105857 AACCACAAGAAAATGAGGCATGG + Intergenic
932934105 2:76081172-76081194 AACCACATCAAACCTCTGCAAGG - Intergenic
933296442 2:80496238-80496260 AGCCCCAGGAAACTAATGTAGGG + Intronic
933493747 2:83021213-83021235 AACTACATGGAACAAAAGCATGG + Intergenic
934247301 2:90318610-90318632 AGCAACAGGAAACCAATGCAAGG + Intergenic
934262024 2:91483993-91484015 AGCAACAGGAAACCAATGCAAGG - Intergenic
934297535 2:91754833-91754855 AACCACATGTAACTGATTCCAGG - Intergenic
934305065 2:91814979-91815001 AGCAACAGGAAACCAATGCAAGG - Intergenic
934328192 2:92037769-92037791 AGCAACAGGAAACCAATGCAAGG + Intergenic
934466572 2:94268306-94268328 AGCAACAGGAAACCAATGCAAGG + Intergenic
934935880 2:98465090-98465112 AACCACAGGAAGCTAATACAAGG - Intronic
935586470 2:104804182-104804204 AGCTACAGGAAACTAATACAGGG - Intergenic
937123826 2:119460251-119460273 AACCAAAAGAAGCTAATGCTTGG + Intronic
937555700 2:123152529-123152551 AACCTCATAAAACTAATCCAGGG - Intergenic
939663023 2:144913964-144913986 AACTACATGAGAAGAATGCATGG + Intergenic
940941435 2:159565865-159565887 TAAGACATGAAACTAATGGAAGG + Intronic
942566401 2:177268457-177268479 AATAAAATGAAACTTATGCATGG - Intronic
944116061 2:196187312-196187334 ATCCTCAGCAAACTAATGCAGGG - Intergenic
944382260 2:199124943-199124965 AACTATAGGAAGCTAATGCAAGG + Intergenic
944466714 2:200008679-200008701 AACCATAAGAAACTACTACAAGG + Intergenic
945673166 2:212826405-212826427 ATCCCCAGGAAACTAATACAAGG + Intergenic
945819653 2:214648303-214648325 AATGACATGAAACTTATGAAAGG + Intergenic
946481769 2:220063888-220063910 AGCCACAAGAAACTAATACAAGG - Intergenic
947191349 2:227508807-227508829 AGCAACCTGAAACTAGTGCAAGG + Intronic
947849851 2:233277285-233277307 GAACAGATGAAATTAATGCAAGG + Intronic
948382074 2:237557779-237557801 ACCCACAGGAAACTAATGCAGGG - Intergenic
1168901281 20:1367270-1367292 AACAATAGGAAACTAATACAGGG - Intronic
1168992609 20:2107528-2107550 GCCCACATGAACATAATGCAGGG + Intronic
1169395663 20:5226751-5226773 AAACACATTAACCTAAGGCAAGG + Intergenic
1169775529 20:9248784-9248806 AACAATAGGAAATTAATGCAGGG - Intronic
1170747959 20:19117464-19117486 AACCAAATGAAAGTAGTGTATGG + Intergenic
1171265903 20:23772356-23772378 ACCCACATGGAACTGATGAAAGG + Intergenic
1176977859 21:15344195-15344217 AATAACATGGAATTAATGCATGG - Intergenic
1178490406 21:33047278-33047300 AATCACAAGAAATAAATGCATGG + Intergenic
1180280476 22:10688942-10688964 AGCAACAGGAAACCAATGCAAGG + Intergenic
1180587698 22:16907478-16907500 AGCAACAGGAAACCAATGCAAGG + Intergenic
1181988390 22:26818025-26818047 AACCACATGAGACTCCTCCATGG + Intergenic
1183130338 22:35828558-35828580 AACCACCTGAAAGAAATACAGGG + Intronic
1183849763 22:40575114-40575136 TACCACAGGAAACTTAGGCATGG - Intronic
949634312 3:5966325-5966347 AGACACATGAAACTGAAGCACGG - Intergenic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
950971014 3:17187891-17187913 ATCCAATTTAAACTAATGCATGG - Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
951615425 3:24538183-24538205 TACCACATGTAACTATTGAATGG - Intergenic
952058665 3:29480480-29480502 AACCAGATGAAGGTAATGCATGG + Intronic
952219002 3:31305358-31305380 AGCCACCTGAAACAAGTGCATGG + Intergenic
952598549 3:35049450-35049472 AACCATTTGAAACTAATGACAGG + Intergenic
953122425 3:40057795-40057817 GAGCACATGAACTTAATGCATGG - Intronic
954652120 3:52171537-52171559 CACCACAGGAAAATAAAGCAGGG - Intergenic
955853220 3:63243995-63244017 AACCAAAGGAATCTAATACAAGG + Intronic
956927945 3:74009652-74009674 AACCACGTAAAACTGATGCCTGG - Intergenic
956985922 3:74700481-74700503 ATACACATGGAACTAATGGAAGG - Intergenic
958435240 3:94088178-94088200 AAGAAGATGAACCTAATGCAGGG - Intronic
958746022 3:98135765-98135787 AACCAAATGAAAATAATAAAAGG + Intergenic
959109086 3:102100232-102100254 AAATAAATGAAGCTAATGCATGG - Intronic
959182947 3:103005594-103005616 ATCCACATTAGACAAATGCATGG - Intergenic
960399019 3:117173029-117173051 AAGTACAGGAAACTGATGCAGGG - Intergenic
962925920 3:139993305-139993327 AACCACATGAATCTAAATCTTGG - Intronic
963383471 3:144560365-144560387 AACCAGTTGAAATTACTGCACGG + Intergenic
963410631 3:144922496-144922518 AACCACATGAAACTGAAGTAGGG - Intergenic
966221746 3:177558207-177558229 AACCACAGGTCACTAATTCAAGG - Intergenic
966455082 3:180105711-180105733 ATCCTCAGCAAACTAATGCAAGG + Intergenic
966868133 3:184272714-184272736 AAACACTAGCAACTAATGCAGGG + Intronic
967312665 3:188120884-188120906 ACACACATGAAAATAATTCAGGG + Intergenic
967549082 3:190768141-190768163 ACCAACATGAAACTAATGTGAGG + Intergenic
967634734 3:191788146-191788168 AACCAAAAGAGACCAATGCAAGG - Intergenic
968400196 4:287863-287885 AACCACCTGAAAAAAATGTATGG - Intronic
968883392 4:3313495-3313517 AACCCCAGGAAACAAATACAAGG - Intronic
969431440 4:7157163-7157185 AGCCACGGGAAACCAATGCAAGG + Intergenic
975713179 4:77180642-77180664 AAACACATGAAGCTACTGAAGGG + Intronic
977761325 4:100740497-100740519 AACAACATGGAACGAATGCCAGG + Intronic
978283104 4:107040452-107040474 CAACAACTGAAACTAATGCAGGG - Intronic
978623216 4:110655300-110655322 AGACACAGGAAAGTAATGCATGG + Intergenic
978900251 4:113940366-113940388 ATCCTCAGCAAACTAATGCAGGG + Intronic
980642713 4:135600443-135600465 AAACATAATAAACTAATGCAAGG + Intergenic
982077443 4:151751761-151751783 AAGCACATGAAAACAATGAAGGG - Intronic
982121023 4:152143885-152143907 AAACACATGAAACACATGAAAGG - Intergenic
982509322 4:156261709-156261731 ATCCACATGAAAGAAATGGAAGG - Intergenic
982524287 4:156457654-156457676 AGCCTCAGGACACTAATGCAGGG + Intergenic
983221479 4:165048162-165048184 AAACAATTGAAACTAATGAAAGG + Intergenic
983280732 4:165678002-165678024 AACTCCATGAATCTAATGCTGGG + Intergenic
984183004 4:176508283-176508305 AACCTAATGAAAATAATACAAGG + Intergenic
984628012 4:182030347-182030369 ATCCTCAGCAAACTAATGCAGGG - Intergenic
984717305 4:182937844-182937866 AACCCCAGCAAACTAATACAGGG - Intergenic
986116356 5:4779273-4779295 ATCCTCAGAAAACTAATGCAGGG + Intergenic
986396427 5:7335302-7335324 AGCCATAGGAAACTAATACAGGG + Intergenic
986945834 5:13018239-13018261 AACCTTATGAAACTAGTGCAAGG + Intergenic
987758608 5:22129298-22129320 AACCACATGGAATTGTTGCAAGG + Intronic
988006819 5:25423386-25423408 AACAACATGAAACAAAAACAGGG + Intergenic
988652955 5:33173757-33173779 GAACACATGAAATCAATGCAAGG - Intergenic
988994571 5:36702576-36702598 ACCCACAGGAAACAAATGCATGG - Intergenic
989239618 5:39188866-39188888 CACCAGATGATTCTAATGCAAGG - Intronic
989651295 5:43693815-43693837 GACCACCTAAAACTAATGAATGG + Intronic
989703636 5:44300983-44301005 AACCAAATAAAACCAATGAAGGG + Intergenic
989795856 5:45471526-45471548 AACAAAAGGAAACAAATGCAAGG - Intronic
990864969 5:60369995-60370017 AAAAAAATGAAACTAATGCTAGG - Intronic
990904212 5:60786418-60786440 AACCCCATGAAAGAAATGTATGG + Intronic
993785066 5:92120839-92120861 AACCAAAGGATACTAATGAATGG + Intergenic
994350494 5:98739867-98739889 ATAAACATGAAACTAATGCCAGG + Intergenic
995758613 5:115540162-115540184 AACCAATTGAAACTAAGGCAGGG - Intronic
996245318 5:121256394-121256416 AACCACCTGAAAATATTACAGGG - Intergenic
996290253 5:121844275-121844297 AACCATAGGAAACTAATACAAGG - Intergenic
996964546 5:129292368-129292390 AACCTCATGAAACTCATTTAGGG + Intergenic
999050513 5:148519347-148519369 AACCACACCAACCCAATGCAGGG - Intronic
1000923820 5:167169813-167169835 AACTACATCAAACAAATGCATGG - Intergenic
1002306020 5:178283762-178283784 AACCACCTGTCACTCATGCAGGG - Intronic
1002397676 5:178970835-178970857 ATCTAGATGACACTAATGCATGG + Intergenic
1004210786 6:13640414-13640436 AACCAAAAAAATCTAATGCAGGG + Intronic
1004581174 6:16954423-16954445 AAACACTTGAAAAGAATGCATGG - Intergenic
1005138516 6:22599763-22599785 AACAAAATGAAATTAATGTAGGG + Intergenic
1007054590 6:38869705-38869727 AACCCCATGAAATTAAAGAACGG - Intronic
1007991328 6:46259304-46259326 AACCACATGAATACAATGCTAGG + Intronic
1008989646 6:57587852-57587874 AGCCAAATGGAAGTAATGCACGG + Intronic
1011009390 6:82686673-82686695 AACCACAAGAAGCAAATGGAAGG + Intergenic
1011833349 6:91401189-91401211 ATTCACAGGAAACTATTGCAAGG - Intergenic
1012589656 6:100965323-100965345 ACTCACATGAAACAAGTGCAGGG - Intergenic
1013457694 6:110346028-110346050 AACCACATGTAGCTTATGTATGG - Intronic
1013946868 6:115731895-115731917 AGCCACAGGAAATTAATACAGGG + Intergenic
1014151752 6:118064910-118064932 AAACACAGGAAACCAATGCAAGG + Intronic
1014263396 6:119247045-119247067 ATACAAATGAAACTAAAGCATGG + Intronic
1014578774 6:123108369-123108391 ATCCTCAGCAAACTAATGCAGGG - Intergenic
1014594363 6:123314719-123314741 ATCCTTAGGAAACTAATGCAGGG + Intronic
1015093714 6:129389435-129389457 TACCACATGAAACTATAACAAGG - Intronic
1015294062 6:131570270-131570292 AGCCATAGGAAACTAATACAAGG + Intergenic
1015469889 6:133592405-133592427 ACCAACATGAAACTAATGTAAGG - Intergenic
1016492231 6:144618984-144619006 AATCACATCAAAGTTATGCATGG - Intronic
1018273482 6:162105314-162105336 AACCACATCAAAATAAAGAATGG + Intronic
1019280341 7:196618-196640 ACACACATGAAGCTAATGCCTGG - Intronic
1020507287 7:9007531-9007553 AACAAAATGAAATTCATGCATGG - Intergenic
1020630523 7:10634027-10634049 GACCACATGAAACTTATGAAAGG - Intergenic
1020948146 7:14641583-14641605 AACCACGTGAAAATAAAGTAAGG - Intronic
1021763556 7:23924869-23924891 AGCCACAGGAAGCTAATACAGGG + Intergenic
1022718257 7:32918310-32918332 AACAACATGAAAAGAATGTAAGG - Intergenic
1022791309 7:33692002-33692024 AGCCATAGGAAACTAATACATGG + Intergenic
1023165482 7:37339169-37339191 CACCAGATGAATCTAATCCAAGG - Intronic
1023550197 7:41361988-41362010 AGCCCCAGGAAACCAATGCAGGG - Intergenic
1024098110 7:46001721-46001743 AACCACATGAATAGAATGAAGGG + Intergenic
1026442061 7:70453461-70453483 AGCCACAGGAAACTAATACACGG - Intronic
1030025173 7:105316665-105316687 AAAGATAAGAAACTAATGCAAGG + Intronic
1038062055 8:23924836-23924858 AGCCACAGGAAACTAATACAGGG - Intergenic
1041190931 8:55353440-55353462 AACCACCAGAAACTACTGAAGGG + Intronic
1041338831 8:56820223-56820245 AAGGTCATGAATCTAATGCACGG + Intergenic
1042101589 8:65280570-65280592 AGCCACAGGAGACTAATCCAGGG - Intergenic
1043825983 8:84929144-84929166 AACCACATTAAACAAATTTATGG - Intergenic
1045507247 8:102787508-102787530 GGCCACAGGAAACTAATACAAGG - Intergenic
1045583822 8:103508239-103508261 AACCACATGAAAATTTTGCATGG + Intronic
1046458034 8:114494240-114494262 AACCACATTAAAATATTGCTTGG + Intergenic
1046501305 8:115081039-115081061 AACAAAATCAAACTTATGCATGG - Intergenic
1046773916 8:118143868-118143890 AGCCACAAGAAACTAACACAAGG - Intergenic
1048019466 8:130525169-130525191 AGCCCCAGGAAACTAATACAAGG + Intergenic
1049537861 8:143190249-143190271 AGCCGCAGGAAACGAATGCAGGG - Intergenic
1051296675 9:15603518-15603540 ATCCTCAGCAAACTAATGCAGGG - Intronic
1051813946 9:21082218-21082240 AACCACAAGGAACTGGTGCAGGG - Intergenic
1052596179 9:30561040-30561062 AACTACATGCAACTATTACAAGG + Intergenic
1053696620 9:40645079-40645101 AGCAACAGGAAACCAATGCAAGG + Intergenic
1053943040 9:43275289-43275311 AGCAACAGGAAACCAATGCAAGG + Intergenic
1054307870 9:63444307-63444329 AGCAACAGGAAACCAATGCAAGG + Intergenic
1054406597 9:64768309-64768331 AGCAACAGGAAACCAATGCAAGG + Intergenic
1054440227 9:65253782-65253804 AGCAACAGGAAACCAATGCAAGG + Intergenic
1054490178 9:65768157-65768179 AGCAACAGGAAACCAATGCAAGG - Intergenic
1055666708 9:78560344-78560366 AGCCCCAGGAAACTAACGCATGG - Intergenic
1056999984 9:91499606-91499628 AACCACAGGAAACAAACACAAGG + Intergenic
1059916122 9:119103110-119103132 AACCACATAAAATTAATTAATGG - Intergenic
1060349631 9:122847774-122847796 AACCAAAGGAAACTAAGTCAAGG + Exonic
1202779071 9_KI270717v1_random:18739-18761 AGCAACAGGAAACCAATGCAAGG + Intergenic
1203586137 Un_KI270747v1:5148-5170 AGCAACAGGAAACCAATGCAAGG + Intergenic
1186497259 X:10021496-10021518 AACCACACAAGACTCATGCAGGG + Intronic
1186851652 X:13585873-13585895 AACAACATGAAGCTGATGCCTGG - Intronic
1187134389 X:16532915-16532937 AACCAGTTTAAACTAATTCAAGG + Intergenic
1187444958 X:19352897-19352919 AAGCACATGGAACTAGTGAAAGG + Intronic
1193431531 X:81412448-81412470 ATCCACATGAGACTAAAGAAGGG + Intergenic
1193619986 X:83739831-83739853 ACCCAAATGAAATTAATTCAAGG + Intergenic
1194829758 X:98607969-98607991 AAACATTTGAAACTAAAGCAAGG + Intergenic
1197216508 X:123871634-123871656 AACCCCAAAAAACTAAGGCATGG - Intronic
1197698310 X:129574933-129574955 GAACACATAAAACTAAAGCAAGG + Intronic
1198170751 X:134103003-134103025 ATCCTCAGCAAACTAATGCAGGG + Intergenic
1198212980 X:134532415-134532437 AACCACATGAAGCAATGGCATGG - Intergenic
1199532859 X:148869650-148869672 AGCCCCAGGAAACTAATACAGGG - Intronic
1199544198 X:148990241-148990263 AAGCACATGTAACCCATGCATGG + Intronic
1199699772 X:150366394-150366416 AACCACAAGAAAGTAATCAAAGG + Intronic
1199902941 X:152195387-152195409 AACCAAAGGAAATTAATACAAGG - Intronic
1201194351 Y:11477013-11477035 AGCAACAGGAAACCAATGCAAGG + Intergenic