ID: 951206164

View in Genome Browser
Species Human (GRCh38)
Location 3:19927772-19927794
Sequence CCTTCCTACTCTGAGACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951206159_951206164 -5 Left 951206159 3:19927754-19927776 CCTCACCCAAATGCACTTCCTTC 0: 1
1: 1
2: 0
3: 34
4: 379
Right 951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 217
951206160_951206164 -10 Left 951206160 3:19927759-19927781 CCCAAATGCACTTCCTTCCTACT 0: 1
1: 0
2: 3
3: 25
4: 274
Right 951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 217
951206158_951206164 18 Left 951206158 3:19927731-19927753 CCATGCTTGACACTGGGTTTCAA 0: 1
1: 0
2: 2
3: 12
4: 168
Right 951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 217
951206155_951206164 26 Left 951206155 3:19927723-19927745 CCTCACAGCCATGCTTGACACTG 0: 1
1: 0
2: 1
3: 14
4: 196
Right 951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951206164 Original CRISPR CCTTCCTACTCTGAGACTCA GGG Intronic
900050918 1:595365-595387 CCTAGCTTCTCTGAGCCTCAAGG + Intergenic
900390553 1:2432101-2432123 GCTGCCTCCTCTGGGACTCACGG + Intronic
900945912 1:5831348-5831370 GCTTCCTCCTCTGTGACCCAAGG - Intergenic
903521850 1:23956747-23956769 CCTTCTTCCCCTGAGAGTCAAGG - Intergenic
904915955 1:33970757-33970779 CCTGCCTGCTCTGAGGCTCAGGG - Intronic
906279803 1:44545450-44545472 ACTTCCTCCTCTGAATCTCAAGG - Intronic
906483944 1:46220293-46220315 TCTTCCTAGTCTCAGACTGAGGG - Exonic
906869904 1:49466683-49466705 CCTTCTTACTCTGAAAACCAGGG + Intronic
912372862 1:109187263-109187285 CCTGCCTCCTGTGAGTCTCAGGG - Intronic
915040201 1:152961927-152961949 CCTTCCGTCTCTGTGGCTCATGG - Intergenic
915440150 1:155940873-155940895 CCTCCCTGCTCTTAGCCTCAAGG + Intergenic
916079793 1:161225293-161225315 CCTTCCTTCCCTGAGTCCCAAGG - Intergenic
916479575 1:165202710-165202732 CCTCCCCACTCTGGGACTCTGGG + Exonic
918067316 1:181110064-181110086 CCTTCCTATTCTCATATTCAAGG - Intergenic
921073710 1:211683409-211683431 CCTTCCTGCTCTGCCACTCTTGG - Intergenic
922702194 1:227768343-227768365 CCTGCCGACTCAGAGGCTCAGGG - Intronic
923254279 1:232207355-232207377 CCTTCCTAATCTGCCACTTAGGG - Intergenic
1063994232 10:11602567-11602589 CCTTCCTTCATTGAGATTCACGG + Intronic
1065190486 10:23203853-23203875 CCTTCCCACTCTTAGACGCCTGG + Exonic
1066275539 10:33864971-33864993 CCTTGGTAATCTGAGCCTCAGGG + Intergenic
1067956119 10:50793609-50793631 ACTTGCTACTCTAACACTCAAGG - Intronic
1069019486 10:63470041-63470063 CCTACATAGTCTGAGAATCAGGG - Intergenic
1069599028 10:69691498-69691520 CCATCCTACTCAGAGCCCCAAGG + Intronic
1069917678 10:71797465-71797487 CCTTCCTACTCTCAGCCTGGGGG - Intronic
1072097314 10:92194703-92194725 TCTTAGTACTCTGAGCCTCAAGG + Intronic
1072413248 10:95225042-95225064 CCTTCTGACTCTGAGATTCTTGG - Intronic
1073735507 10:106341356-106341378 CATTCCTAATCTGAGACCCTAGG + Intergenic
1076542257 10:131221515-131221537 ACTTCCTACTTGGAGCCTCATGG - Intronic
1076568441 10:131414659-131414681 CTTTCCTCCTCTGAGAAACAAGG + Intergenic
1078379294 11:10825649-10825671 CCTTCAAACTCTCAGGCTCAAGG + Intronic
1080037854 11:27728068-27728090 CCTTTCATCTCTGAGATTCAGGG - Intergenic
1080111395 11:28572012-28572034 CCTTACCACTCTGAGAGACAAGG + Intergenic
1083306693 11:61765383-61765405 CTCTCCTCCTCTGAGACTCAAGG + Intronic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1083772566 11:64876694-64876716 CCTTCCAGCTCTGAAACTCTAGG + Intronic
1085627617 11:78085392-78085414 CCTTCCTACTCTTAGTCCCCTGG + Intergenic
1085719602 11:78901540-78901562 ACTTCCTATTCTGAGTCTCCAGG - Intronic
1092310725 12:7348965-7348987 GCTCCCTCCTCTGAGACTTAAGG + Intronic
1094692922 12:32787204-32787226 CCTACCTTCCCTGAGGCTCATGG - Intergenic
1096813099 12:54183992-54184014 CCCTCCTACTCTGTGGCTGAGGG - Intronic
1097532084 12:60814727-60814749 CCCTCCTACTCTGTGTCTCTTGG - Intergenic
1098111215 12:67123755-67123777 CCTTTCAACTCTGAGATTCTAGG + Intergenic
1099993790 12:89754747-89754769 CCTTCCTATTCAGAGCCTCTTGG + Intergenic
1100603926 12:96135455-96135477 GCTTTCTTCTCTGAGACTGATGG + Intergenic
1105539995 13:21307946-21307968 AGTTCCTACTCAGAGACTCAAGG - Intergenic
1106726835 13:32495162-32495184 CCTTTGAAGTCTGAGACTCATGG - Intronic
1108605538 13:52034538-52034560 CTTTCTTACTCTGTCACTCAAGG + Intronic
1111693326 13:91592565-91592587 CCTTCATGCTCTGAGACTGTGGG + Intronic
1112045795 13:95596422-95596444 CCTTCCAACTCAGAAATTCAAGG - Intronic
1112375411 13:98835660-98835682 CCTTCCCATTCTGAGACTGGAGG + Intronic
1113032023 13:106004209-106004231 CCTTCCGACTCTGAGTCAGAAGG + Intergenic
1115302930 14:31904355-31904377 CCTTCCTCCTCTGAGCCTCATGG + Intergenic
1118381928 14:65224628-65224650 CCTTCCTATTCTCAGTCCCAGGG - Intergenic
1119252955 14:73172873-73172895 CCTTCCTACTGTCAGAATGAAGG - Intronic
1119866379 14:77978534-77978556 GCTTGCTAATCTGAGCCTCAAGG - Intergenic
1120109750 14:80540228-80540250 ACTTGCTGGTCTGAGACTCAGGG + Intronic
1121325597 14:93017946-93017968 CCTTCCTGCTGTGAGACCCTAGG - Intronic
1122941025 14:104981428-104981450 CCTGCCCACTCTGAGACAGAGGG + Intergenic
1123919108 15:25058096-25058118 CCTGGCTACGCTGAGACTAACGG - Intergenic
1124467446 15:29950839-29950861 ACTTCCTACTATGAGACTGGTGG - Intronic
1124588485 15:31033123-31033145 CCTCCCTATTCTTAGATTCAGGG + Intronic
1125655231 15:41351313-41351335 CCATGCTTCTCTGAGACTCTGGG + Intronic
1128339142 15:66808353-66808375 TCTTCCTCCTCTGAGGCTCCTGG - Intergenic
1128800008 15:70491250-70491272 CCTTCTCACTGTGTGACTCATGG - Intergenic
1128811589 15:70577008-70577030 CCTTCCAACTCTGAGACTCGAGG - Intergenic
1129300713 15:74623976-74623998 CCTTCCTGCCCTGAGAATCTGGG + Intronic
1130352833 15:83107210-83107232 CCTTCCTCCTCTGACACCCTCGG + Intergenic
1130644342 15:85710510-85710532 CCTTCCTACTCGGCTTCTCAGGG + Intronic
1133359421 16:5162221-5162243 ACTTGCTGGTCTGAGACTCAGGG + Intergenic
1135611792 16:23874019-23874041 CCTTCCAACTTTGAAATTCAAGG - Intronic
1136295084 16:29297053-29297075 CATTCCCTCTCTGAGCCTCAGGG + Intergenic
1138314821 16:56060885-56060907 CCTTCCCACCCTGTGACTGAGGG + Intergenic
1141092038 16:81137083-81137105 GCTTTCTTCTCCGAGACTCAGGG - Intergenic
1141400731 16:83744782-83744804 ACTTCCTCCTCTGTGACTCGGGG - Intronic
1142100985 16:88271062-88271084 CATTCCCTCTCTGAGCCTCAGGG + Intergenic
1142552005 17:746608-746630 CCTGCCGGATCTGAGACTCAGGG + Exonic
1142877394 17:2860137-2860159 CCTTCCAGCTCTGGGACTCTGGG - Intronic
1146591010 17:34127985-34128007 CCTTGCCTCTCTGAGATTCAGGG - Intronic
1146594985 17:34160860-34160882 AATTGCTACTCTGAGACGCAAGG + Intronic
1147559904 17:41502307-41502329 CCTGCCTGCTCTGACACCCACGG + Intronic
1151850610 17:76687624-76687646 CCTTTCTCCTCTCAGTCTCATGG + Intronic
1152250776 17:79211609-79211631 CCTTCCCACGCTCAGACTCCGGG + Intronic
1162638051 19:11985705-11985727 CCTTCCTGCTCTGAGGCAAAGGG + Intergenic
1166744757 19:45136216-45136238 CATCACTACTCTGAGACTGAAGG - Intronic
1168708344 19:58482437-58482459 CCTTCCTACTCTGAAAACAAGGG + Intronic
927517782 2:23682126-23682148 CCTTCCTGCACTGAGCCCCACGG + Intronic
927880816 2:26688780-26688802 CCTTCCTGCTCTGACATTCTGGG - Intergenic
928978608 2:37115666-37115688 CCTTCCAACTTTGAGATTCTCGG + Intronic
928999474 2:37332017-37332039 CCTGCCAACTCCGAGACTAATGG - Intergenic
929079719 2:38110350-38110372 CATTCTTAATTTGAGACTCATGG - Intergenic
929106816 2:38373594-38373616 ACTACCTACTCTGAGACAAATGG - Intronic
929608485 2:43251987-43252009 CCGTCCAAGTCAGAGACTCAGGG - Intronic
933743194 2:85551130-85551152 CCTCCCTACTCTATGACTCTTGG + Intronic
934560197 2:95309241-95309263 CCTCCCTCCTCTGTGCCTCATGG + Intronic
935124800 2:100214008-100214030 CATTCCTAGCCTGAGGCTCATGG + Intergenic
937666725 2:124496223-124496245 CCTTCCTATTCACAAACTCAGGG - Intronic
938986521 2:136581624-136581646 CCTACCCACTCAGAGACTCCAGG + Intergenic
940089106 2:149896380-149896402 CTTTCTTACTCTGAGAAACAGGG - Intergenic
940336738 2:152536788-152536810 CCTTCATATTCTGAGGCTTAAGG - Intronic
941387387 2:164870180-164870202 CCATCTTACATTGAGACTCAAGG - Intergenic
947041488 2:225926348-225926370 GCTTCCTTCTCTGAGACTAGAGG + Intergenic
947359278 2:229331423-229331445 CCTACCTGCTGTGAGACTCTGGG + Intergenic
948264442 2:236626807-236626829 CCCTCTCACCCTGAGACTCATGG - Intergenic
948792743 2:240387828-240387850 CCTTCCAGCTCTGGGACTCTGGG - Intergenic
1168954222 20:1823568-1823590 CCTGCCCTCTCTGAGCCTCAGGG - Intergenic
1169776681 20:9262885-9262907 CCTGCTTACTCTGAGATTCCTGG - Intronic
1171195132 20:23190978-23191000 CATTCTTACTCTGAGATTCAAGG - Intergenic
1171862332 20:30412577-30412599 TCTCCCTTCTCTGTGACTCAGGG - Intergenic
1172413208 20:34741953-34741975 CCTTCCTACTCTGGGAATTCTGG + Exonic
1172801626 20:37580260-37580282 CCATCCTACTGTGTGACCCAGGG - Intergenic
1173531970 20:43776707-43776729 CCATGCTCCTCTGAGACTCTGGG + Intergenic
1174064197 20:47852884-47852906 CCTCCCTTCTCTGGGCCTCATGG - Intergenic
1174747300 20:53076034-53076056 CCTTTCGACTCTGAGACCCTAGG + Intronic
1175264801 20:57696095-57696117 CCCTCCTGCTCTGAGCCCCAGGG + Intronic
1175738141 20:61401274-61401296 CCTTCCTTCTCAAAGACCCATGG - Intronic
1179518932 21:41929477-41929499 CCTTCTTTCTCTGAGCCACAGGG - Intronic
1179891016 21:44335137-44335159 CCTGCCTACTGTGGGACCCACGG - Intronic
1182301911 22:29341782-29341804 CCTGGCTACTCTGAGTTTCATGG - Intronic
950710977 3:14812453-14812475 CCTCCCTTCTCTGAGAATCTGGG + Intergenic
951206164 3:19927772-19927794 CCTTCCTACTCTGAGACTCAGGG + Intronic
952340157 3:32438775-32438797 TCTTCCTGCTCTGAGCCTCCAGG - Intronic
952808150 3:37376919-37376941 CCTTCCTCCTCTGTAACTAAAGG + Intergenic
952817445 3:37457894-37457916 CCTTCACACTCTCACACTCAGGG - Intronic
953029375 3:39168424-39168446 CCTGCCGGCTCTGAGATTCATGG + Intergenic
956219346 3:66884977-66884999 TCTTCCCTCTCTGAGACTCAAGG + Intergenic
957064670 3:75511732-75511754 ACTTGCTGGTCTGAGACTCAGGG + Intergenic
958843241 3:99234003-99234025 ACTTGCTATTCTGAGACTTAGGG + Intergenic
959096576 3:101963172-101963194 TTTTACTACTCTGAGGCTCAAGG - Intergenic
959944109 3:112109701-112109723 CCTTCATGCTCTGAGGCTCTGGG - Intronic
960347605 3:116553609-116553631 CCATGCTCCTCTGAGACTGAAGG - Intronic
961288684 3:125827662-125827684 ACTTGCTGGTCTGAGACTCAGGG - Intergenic
961485381 3:127212233-127212255 CCTTTCTTCTGTGAGACTCCGGG - Intergenic
961769548 3:129238962-129238984 CCTTCCTGCTCTCAAACTCCTGG + Intergenic
962304279 3:134272036-134272058 CCTTCCAACTCTGTGACTCCAGG + Intergenic
962542018 3:136391856-136391878 GCTTCCAACTCTGGGAATCAGGG + Intronic
965456288 3:168904819-168904841 CCTTCCAAATCTAAGATTCAAGG + Intergenic
965654339 3:170967959-170967981 CCTTCCAATTCTGAGAATGATGG - Intergenic
966254750 3:177905043-177905065 CTTAGCTTCTCTGAGACTCATGG - Intergenic
969008568 4:4041837-4041859 ACTTGCTCATCTGAGACTCAGGG + Intergenic
969185291 4:5469861-5469883 CCTGCCTGCTCTGAGGCTCATGG + Intronic
969804404 4:9595553-9595575 ACTTGCTGGTCTGAGACTCAGGG - Intergenic
970417624 4:15874937-15874959 CCTTCTTACCCTGAGAAACACGG + Intergenic
973291851 4:48478856-48478878 CCTGCCTACTCAGTGACTAATGG + Intergenic
979404720 4:120295388-120295410 CCTTCCTACTCTGTGGCTTAGGG + Intergenic
979526230 4:121720146-121720168 TCTTCCTTCTCTGACACACATGG + Intergenic
979782595 4:124671800-124671822 CCTTTCTACTTTGATACCCAAGG - Exonic
982743935 4:159086793-159086815 CCTACCTCCTGTGAGCCTCAAGG - Intergenic
983569005 4:169184488-169184510 CTATCCTCCTGTGAGACTCAGGG - Intronic
987780851 5:22433093-22433115 CATTCCTACTCTGGGTCCCATGG - Intronic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
999116147 5:149165118-149165140 CCTTCCCACTGTGAGATTCAAGG - Intronic
999466031 5:151805960-151805982 TCTTCCTACTTGGAGACTTAAGG + Exonic
999665799 5:153911557-153911579 CTTTCCTACTCTGACATTCTAGG - Intergenic
1001015014 5:168132814-168132836 CCTTCCAAGTCTGTGACTCTGGG + Intronic
1004911350 6:20288013-20288035 ACTTCGAACTCTGAGGCTCAAGG - Intergenic
1006321419 6:33321789-33321811 CCTAGCTCCTCTGAGCCTCATGG - Exonic
1006738184 6:36290017-36290039 CCTTCCAACTTTGAGATTCTGGG - Intronic
1006887806 6:37397010-37397032 CCTTCCTCCCCTGGGACACATGG + Intergenic
1010524250 6:76880947-76880969 CCCTCCTACTCCCAGCCTCAGGG + Intergenic
1012919314 6:105204933-105204955 CCTGCCTACTCTGAGAAAGAAGG - Intergenic
1013591553 6:111623198-111623220 CCTACCTGCTCTCAGAATCAAGG + Intergenic
1014561436 6:122895854-122895876 CACTCCTTCTCTCAGACTCAAGG + Intergenic
1016002873 6:139060185-139060207 ACTTTATACTCTGAGACTAAGGG + Intergenic
1016705419 6:147101358-147101380 CCTTCCGAATTTGAGACTTATGG + Intergenic
1017920589 6:158869137-158869159 CATTGCTTCTCTGAGTCTCAAGG - Intergenic
1017953463 6:159158320-159158342 CCTTCCTAGTTTGAGAATCCTGG + Intergenic
1018680169 6:166258028-166258050 CAGTCCTTCTCTGTGACTCAGGG + Intergenic
1018906950 6:168081051-168081073 CCTTCCCACCCAGAGTCTCAGGG + Intronic
1020329036 7:6999630-6999652 ACTTGCTCATCTGAGACTCAGGG + Intergenic
1021957764 7:25843269-25843291 GCTTCTGTCTCTGAGACTCAGGG + Intergenic
1022275734 7:28854059-28854081 CCCTCTTACTCTCAGACCCAGGG - Intergenic
1022591039 7:31663128-31663150 TCTTCATACTCTGATTCTCATGG + Intergenic
1023092007 7:36625859-36625881 CCTTCCTGCTCTGATGCTCCAGG + Intronic
1023205678 7:37746932-37746954 CCTTCCTATTGTAAGAATCATGG - Intronic
1023751475 7:43377147-43377169 CCTCCCTACTCTGGGTCTCATGG - Intronic
1023943009 7:44782108-44782130 CAATCCTGCTCTGAGACTCAGGG - Intergenic
1026234666 7:68516463-68516485 TTTTCATACACTGAGACTCAGGG - Intergenic
1028894785 7:96028986-96029008 CCTTGCTACCTTGACACTCAGGG + Intronic
1028986340 7:97011963-97011985 CCTTCCTACTGTGAAACTTTGGG + Intergenic
1029108472 7:98197271-98197293 TTTACCTACTCTGAGCCTCAGGG - Intronic
1029151056 7:98480837-98480859 CCATCCTATGCTGAGACTCCAGG + Intergenic
1031188612 7:118516799-118516821 CCTTTCTTCTCTGAGCCTTATGG - Intergenic
1032394881 7:131582050-131582072 CCTGGCTCCTCTGAGACTCAAGG + Intergenic
1034863059 7:154616565-154616587 CATTCCTTCTCTGTGACTCTCGG + Intronic
1034944581 7:155253685-155253707 CCGTCCTCCTCTGAGGCTGAGGG + Intergenic
1035315547 7:157995581-157995603 CCATCCTACTCTAAGACTGCAGG - Intronic
1035499464 8:80035-80057 CCTAGCTTCTCTGAGCCTCAAGG + Intergenic
1036067568 8:5399602-5399624 CCTTCCTACTCTGATATTTTAGG - Intergenic
1036249853 8:7152494-7152516 ACTTGCTCATCTGAGACTCAGGG + Intergenic
1036367648 8:8134944-8134966 ACTTGCTCATCTGAGACTCAGGG - Intergenic
1036558700 8:9883661-9883683 GCTTCCTGCTCTGCGACTCTGGG + Intergenic
1036646473 8:10613709-10613731 GCCTCCAACTCTGGGACTCAGGG - Intronic
1036883232 8:12530717-12530739 ACTTGCTCATCTGAGACTCAGGG + Intergenic
1037219488 8:16500177-16500199 CCTTCCTACTCTCTGTTTCAAGG + Intronic
1037660578 8:20923026-20923048 CCTTCCAAATCTGAGCCTCTGGG - Intergenic
1040344341 8:46473522-46473544 CCTTCTTACTATAAGTCTCAGGG + Intergenic
1043850492 8:85210894-85210916 CCTAACTACTCTGAAATTCAAGG - Intronic
1044847045 8:96392282-96392304 CCTTCCAACACTAAGACTCTAGG - Intergenic
1046097814 8:109580987-109581009 ACTTCCTACTTTGAGACTGATGG + Intronic
1047785598 8:128151406-128151428 CTTTCCTACTCAGAGACTGGTGG - Intergenic
1047922227 8:129647079-129647101 ACTTGCTGGTCTGAGACTCAGGG - Intergenic
1048199051 8:132356422-132356444 TCTTCCTACTTTGAGGCTCTGGG + Intronic
1048281096 8:133106200-133106222 CCTTCCTCCTCTTGGACTGAGGG - Intronic
1048357457 8:133665190-133665212 CCTCCCTTCTCTGAGGCTCATGG - Intergenic
1049068244 8:140336583-140336605 CCTGTCTACTCTGACACTGATGG + Intronic
1049653596 8:143788145-143788167 CCTTCCTGCTCTGGGAAGCAGGG - Intergenic
1050512296 9:6408710-6408732 TCTTCCTACTCTTGGACTCTAGG + Intergenic
1051674739 9:19547590-19547612 CCTCCCAATTCTGAGAGTCAAGG + Intronic
1055231187 9:74067625-74067647 CCTTGTTTCTCTAAGACTCACGG + Intergenic
1055662450 9:78518699-78518721 CCTGCCTACACAGAGCCTCAGGG - Intergenic
1056595755 9:88006737-88006759 CATCCCTACTCTCAGGCTCAGGG + Intergenic
1058232085 9:102438522-102438544 CTTTCCTGCTCTAAAACTCAGGG - Intergenic
1059004337 9:110384671-110384693 CCTTACTTCTCTGAGTCTGAGGG - Intronic
1059225491 9:112669196-112669218 CCTTCCAACGCTGACACTCTAGG - Intronic
1059455875 9:114399855-114399877 CCTTCCTACACTGACATTCCAGG - Intergenic
1059849662 9:118323383-118323405 TCTTCATCCTGTGAGACTCAGGG + Intergenic
1060030715 9:120212650-120212672 CCTTCCAACCCTGAGATTAATGG + Intergenic
1060640015 9:125230486-125230508 CCTTCTTACTCTGAGATGCTGGG + Intronic
1062211346 9:135365964-135365986 CCTTCCTTCACCCAGACTCACGG + Intergenic
1188649020 X:32607280-32607302 CATTCTTACACTGAGATTCATGG + Intronic
1189473406 X:41331751-41331773 CCTTCCTGCCCTGAGATTCGTGG - Intergenic
1191659973 X:63639114-63639136 CCTTCCTCATCTGCTACTCAGGG + Intronic
1191920311 X:66249125-66249147 ACTTCCCCCTCTGAGGCTCAAGG + Intronic
1192151838 X:68717550-68717572 CCTTCCGCCTCAGAGATTCAAGG - Exonic
1193663291 X:84283626-84283648 CCTTCCAACTCTAAGATTCTTGG - Intergenic
1195245291 X:102989910-102989932 CCTCTCTACTCTGACACTGAAGG - Intergenic
1196841386 X:119862388-119862410 TTTTCCTACTCTCACACTCAAGG - Intergenic
1197004736 X:121481904-121481926 ACTTGCTGGTCTGAGACTCAGGG + Intergenic
1198528467 X:137525621-137525643 CCTTCCCACTGTGATCCTCAGGG + Intergenic
1199700404 X:150371307-150371329 CCATCCTTCTCTGAACCTCAGGG - Intronic
1199757021 X:150874343-150874365 TCTTCCTATTCTGAGAATGATGG - Intronic
1200077828 X:153560446-153560468 CCTTCCTGCCCTCAGGCTCAGGG + Intronic
1200702268 Y:6412315-6412337 CCTGCATACTCTTAGACACAAGG - Intergenic
1201031843 Y:9752383-9752405 CCTGCATACTCTTAGACACAAGG + Intergenic
1201998863 Y:20127632-20127654 CCTTCCTTCTGGGAGATTCATGG + Intergenic
1202005880 Y:20271069-20271091 CCTTCCTTCTGGGAGATTCATGG + Intergenic