ID: 951209701

View in Genome Browser
Species Human (GRCh38)
Location 3:19961958-19961980
Sequence AAGCCCACTCACCAGAACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951209701_951209707 30 Left 951209701 3:19961958-19961980 CCATGGTTCTGGTGAGTGGGCTT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 951209707 3:19962011-19962033 TGCTCTTGCAGTTCATTACGGGG 0: 1
1: 0
2: 0
3: 4
4: 69
951209701_951209705 28 Left 951209701 3:19961958-19961980 CCATGGTTCTGGTGAGTGGGCTT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 951209705 3:19962009-19962031 CTTGCTCTTGCAGTTCATTACGG 0: 1
1: 0
2: 0
3: 17
4: 188
951209701_951209706 29 Left 951209701 3:19961958-19961980 CCATGGTTCTGGTGAGTGGGCTT 0: 1
1: 0
2: 0
3: 17
4: 128
Right 951209706 3:19962010-19962032 TTGCTCTTGCAGTTCATTACGGG 0: 1
1: 0
2: 1
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951209701 Original CRISPR AAGCCCACTCACCAGAACCA TGG (reversed) Intronic
904026684 1:27508291-27508313 AAGCCCACACTCCTCAACCAAGG + Intergenic
904348371 1:29888821-29888843 AACCACCCTCACTAGAACCAGGG + Intergenic
906787151 1:48626165-48626187 AAGCACCCACACCAGCACCATGG - Intronic
917656607 1:177132490-177132512 AAGCCCACTCATCAGGAGGAAGG + Intronic
918041998 1:180919205-180919227 AAGCCCAATCACATGAACCTGGG - Intronic
918949243 1:191114272-191114294 AGGCACACCCACCAGCACCATGG + Intergenic
922810047 1:228410306-228410328 AAGCCCCCTCTCCAGGGCCATGG + Intronic
923203892 1:231739493-231739515 TGGTCCACTCACCAGCACCAAGG - Intronic
1062858888 10:794530-794552 CAGCACAATCACCAGCACCAAGG - Intergenic
1063696543 10:8340989-8341011 AAGCTAACTCAGCAGAGCCATGG - Intergenic
1068950273 10:62769778-62769800 AAGCCCAGTAACCAAAATCAGGG - Intergenic
1070746963 10:78939563-78939585 AAGCCCACTGCCCACAACCAGGG + Intergenic
1073451300 10:103611047-103611069 AACCCCACCCACATGAACCAGGG + Intronic
1074222404 10:111450896-111450918 AAGCCGACTCACCAGATCAATGG - Intergenic
1076438370 10:130462199-130462221 ATGCCCACTCATCAGATCCTGGG + Intergenic
1077046933 11:550898-550920 GACCCCACTCTCCAGACCCAAGG - Intronic
1080975347 11:37333172-37333194 TGGCCAACTCAGCAGAACCATGG + Intergenic
1081809738 11:45908117-45908139 AACCTGGCTCACCAGAACCATGG + Intergenic
1083474688 11:62908480-62908502 AGCCCCACTCACCTGAGCCAGGG + Intergenic
1086101691 11:83106879-83106901 AAGGCCACCCACTGGAACCATGG + Intergenic
1088257601 11:107915877-107915899 TAGCCCAATGACCACAACCAAGG - Intronic
1089453768 11:118613886-118613908 GATCCCACTCACCTGCACCATGG - Exonic
1090844391 11:130518743-130518765 AAACCAATTCACCAAAACCATGG - Intergenic
1092696546 12:11177934-11177956 AGTCCCACTCACTAGAAGCAAGG + Intergenic
1092746083 12:11673875-11673897 AACTCCACTCACAAGAGCCATGG - Intronic
1098874171 12:75849669-75849691 AGGCCCTCTCACCAGAGCCTGGG + Intergenic
1098960986 12:76739487-76739509 AAGCCTCCTGGCCAGAACCAGGG - Intergenic
1107372200 13:39765383-39765405 AATCCCACTCACCCAATCCAGGG - Intronic
1107872463 13:44759963-44759985 AAATCCTCTCACCAAAACCATGG - Intergenic
1110561799 13:76917747-76917769 AAGCCTCCTGGCCAGAACCAGGG + Intergenic
1110857609 13:80313586-80313608 AAGCTGACGCACCAAAACCATGG + Intergenic
1112035440 13:95492666-95492688 AAGCCTCCTGACCAGAACCTAGG - Intronic
1115019693 14:28661265-28661287 CAGCCCACCCACCAGAATCCAGG + Intergenic
1115969748 14:38932271-38932293 AAGCCCCCTGACCAGAACTCGGG + Intergenic
1117245823 14:53885895-53885917 GTGCACACTCACTAGAACCATGG + Intergenic
1120897603 14:89547751-89547773 ATCCCCACTGACCAGCACCAAGG + Intronic
1122617772 14:103032201-103032223 ATGCCCACCCACGAGGACCAAGG + Intronic
1125056564 15:35365210-35365232 AAACCCAATCACCAAATCCATGG + Intronic
1127464981 15:59235030-59235052 AAGCCTGCTCCCCAGAGCCATGG - Intronic
1128064059 15:64753644-64753666 AAGCCCATTCAGCAGAATCTCGG + Intronic
1129206372 15:74039198-74039220 ATGCACACTCACCAGTGCCACGG - Intronic
1129489178 15:75906341-75906363 AAGCCCAGTCATTAGAGCCAAGG + Intronic
1130891159 15:88135184-88135206 AAGCCCACCCACTACAACAATGG - Exonic
1131184357 15:90262556-90262578 AAGGCCAGGGACCAGAACCAGGG + Intronic
1134503785 16:14789506-14789528 AATCCCACCCACCTGACCCAAGG - Intronic
1134576787 16:15339393-15339415 AATCCCACCCACCTGACCCAAGG + Intergenic
1134725655 16:16417096-16417118 AATCCCACCCACCTGACCCAAGG - Intergenic
1134941779 16:18294762-18294784 AATCCCACCCACCTGACCCAAGG + Intergenic
1136170693 16:28487517-28487539 AATCCCACTGACGAGAACCCGGG + Exonic
1141512940 16:84524449-84524471 AAGCCTGCTCACCAGGGCCATGG - Intronic
1144001444 17:11058893-11058915 AAGACCCCTCACCAGACCCCTGG + Intergenic
1144767719 17:17741783-17741805 AAGCACACTCCCCACATCCAGGG + Intronic
1145036248 17:19542703-19542725 CAGCCCAATCCCCAGAACCTAGG - Intronic
1149035293 17:52127344-52127366 AAGCCCACCCACCAGAAATGGGG - Intronic
1150494230 17:65594816-65594838 AAGCCCAGACCCCAGAACCCAGG - Intronic
1151534208 17:74729597-74729619 AGGCACCCTCACCAGAACCCAGG + Intronic
1151890759 17:76949294-76949316 AGGCCCACTCTCCAGGGCCATGG - Exonic
1155222329 18:23696912-23696934 AAGACCACACCCCAGAACCAAGG - Intronic
1156003709 18:32415512-32415534 AAGCTCATTCATCATAACCAAGG + Intronic
1156625451 18:38902429-38902451 AATCCCATTAACCAGAACCAAGG + Intergenic
1160556035 18:79725861-79725883 AAGATCACTCATCAGAACCACGG - Intronic
1160778201 19:866377-866399 CAGCCAGGTCACCAGAACCACGG + Intergenic
1163460900 19:17436830-17436852 CAGCACAGCCACCAGAACCAGGG + Exonic
1165804480 19:38572283-38572305 AAGCCCTTGCCCCAGAACCATGG - Intronic
925059558 2:880509-880531 AAGCCCACTCACCAGAGCTCTGG - Intergenic
925159652 2:1675163-1675185 AATCCCCCCCACCAGAAACACGG + Intronic
928942021 2:36735789-36735811 AAGCCCAATCCCCTGAAACAAGG + Intronic
930030153 2:47053496-47053518 AAACCCGCCCACCAAAACCAAGG - Intronic
930230907 2:48842986-48843008 AAGCACACTCAGCAGCACCAGGG - Intergenic
930483013 2:51972902-51972924 AAGCCCACTCACCTGACCTGTGG - Intergenic
933649037 2:84834068-84834090 AAGCCCACACTCCAGCACCTGGG + Intronic
938183158 2:129203078-129203100 AAACCCACACAGAAGAACCAGGG - Intergenic
938488123 2:131735879-131735901 CACCCCACTCACCCAAACCAGGG - Intronic
938957591 2:136313837-136313859 AGTCCCTCTCACAAGAACCAGGG - Intergenic
939243979 2:139599219-139599241 GAGCGCCCTCACCAGAACCATGG - Intergenic
945190664 2:207184453-207184475 AAGCTGACCCACCTGAACCAGGG + Intergenic
1170547977 20:17451058-17451080 AAACCCAATCACCAGAAGCAAGG + Intronic
1172513444 20:35516078-35516100 AAGCCCATCCACCTGAGCCAAGG - Exonic
1174701681 20:52615609-52615631 AAGACCACTCATCTGAACAAAGG + Intergenic
1175430423 20:58898278-58898300 AAGCCCACCCACCACCACCACGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1178962413 21:37077761-37077783 AAGACAACTCATCAGAACAAAGG - Intronic
1180898804 22:19356485-19356507 AAGCCCAGGCAACAGAGCCATGG + Intronic
1183124075 22:35758391-35758413 GAGACTACTCACCAGAAACATGG - Intronic
1184904321 22:47469969-47469991 GACCCCACTTACCAAAACCATGG + Intronic
1185048328 22:48540275-48540297 AAGCCTGCTCCCCAGGACCAGGG + Intronic
1185136323 22:49075246-49075268 AAACCCACTGAGCAGAATCAGGG + Intergenic
950031164 3:9854733-9854755 AAGCACACTCTCCAGAACAGTGG + Intronic
951209701 3:19961958-19961980 AAGCCCACTCACCAGAACCATGG - Intronic
951606401 3:24439400-24439422 ACGCCCTCTCACGAGAACTATGG + Intronic
951932151 3:27980431-27980453 ACTCCCATTCCCCAGAACCATGG - Intergenic
954714478 3:52520289-52520311 AAGCCCTCTCCCCAGACTCACGG - Exonic
961783311 3:129334358-129334380 AAGCGCACTCTCCAGAACAGTGG + Intergenic
963491324 3:146004998-146005020 CACCCCACTCTCCAGATCCATGG + Intergenic
965200666 3:165653977-165653999 AAACCAATTCACCAAAACCATGG - Intergenic
967105049 3:186249000-186249022 AAGCCCACGCTCCAGAACCCCGG + Intronic
967868350 3:194208639-194208661 AAGGCCACCCATCTGAACCATGG + Intergenic
976248881 4:83030878-83030900 AAATCCTCTCAGCAGAACCAAGG + Intergenic
979222067 4:118238838-118238860 AAGCCCAAATACCAGAACCATGG + Intronic
986032113 5:3904716-3904738 AAGCCCACTCCCCACACGCATGG + Intergenic
986735711 5:10665983-10666005 AAGGCCACGCACCAGAGCCGGGG - Intergenic
987660242 5:20863160-20863182 AAGTAGACTGACCAGAACCATGG + Intergenic
992027377 5:72683743-72683765 AAGCCCACTCCCCAGGTACAGGG - Intergenic
998341095 5:141418652-141418674 AAGGCCACTGACCAGGACGAGGG + Exonic
999397847 5:151241632-151241654 AAGACCACTCAGCAGAGCTAGGG - Intronic
1000182216 5:158822434-158822456 AATGCCACTCAGAAGAACCATGG - Intronic
1002394594 5:178942814-178942836 ACCCCCACTCACCTGGACCATGG - Exonic
1005804741 6:29463598-29463620 AAGCACACTCATGAGAAGCAAGG - Exonic
1007724719 6:43908256-43908278 AAGGCCACACAGCAGAGCCAGGG - Intergenic
1008927214 6:56899720-56899742 AAGCCCATGAGCCAGAACCAAGG + Intronic
1024552783 7:50577464-50577486 AGGCCCAATCACCAAAAACAGGG - Intergenic
1025238359 7:57250593-57250615 GGACCCTCTCACCAGAACCAGGG - Intergenic
1027831867 7:83187214-83187236 GAGCCCACTGAGCAGAAACATGG + Intergenic
1027988156 7:85321675-85321697 CAGCCCACTCTCCATAAACAGGG - Intergenic
1029190274 7:98766988-98767010 AGGCCCACTCAACAGCGCCACGG + Intergenic
1030701661 7:112647308-112647330 AAGCCCACACCCCACAGCCAAGG - Intergenic
1030712858 7:112772787-112772809 GAGCCCACTCTCCTGTACCATGG + Exonic
1033423321 7:141221603-141221625 TAGCCCACTTATAAGAACCAGGG + Intronic
1034496251 7:151424633-151424655 AGGCACACACACCAGAACCAAGG + Intergenic
1035071665 7:156149294-156149316 AAGCCCATTAACCAGGACCAAGG + Intergenic
1037462661 8:19128483-19128505 AAGCTCACTCACCACTCCCAAGG - Intergenic
1039948351 8:42149229-42149251 CAGCCCACTCTCCTGAACCCTGG + Intergenic
1041087871 8:54273259-54273281 AAGCCCACTCATTAGACCCCTGG - Intergenic
1041280641 8:56208965-56208987 AAGCACACACACCAACACCATGG - Intronic
1048224403 8:132570790-132570812 AAGCCCACCCACCAGGATCTTGG + Intergenic
1048856548 8:138691050-138691072 AAGCCCACTCACCTGAGGCTTGG - Intronic
1048983032 8:139713385-139713407 AAGTCCACTCACAGGGACCAGGG + Intergenic
1056248868 9:84727848-84727870 AATCCCACTCACATGAACAATGG + Exonic
1057910937 9:99020291-99020313 CAGCTCACTGACCAGGACCAGGG + Intronic
1058763999 9:108163862-108163884 ACGCCCACACACCAGCACAAGGG - Intergenic
1060503370 9:124179859-124179881 AAGCTCAGTCAACAGAACCCAGG - Intergenic
1061956337 9:133963318-133963340 AACGCCACTGACCAGAACCAAGG + Intronic
1062680026 9:137774380-137774402 GACCACACTCACCAGATCCAGGG - Intronic
1186152856 X:6693345-6693367 AAGCCCCCTCTCCCCAACCATGG - Intergenic
1188284990 X:28315999-28316021 AAGCCCACTCACCAGGGTCCTGG + Intergenic
1189208549 X:39263144-39263166 AAGGGCACTCACCACCACCAAGG - Intergenic
1192080241 X:68040772-68040794 AAGGCCACACACCAGAGCCAGGG - Intergenic
1192529982 X:71875419-71875441 AAACCCAGTCACCTGAACTATGG - Intergenic
1192584760 X:72310147-72310169 AATCCCACCCTCCAGAACCAAGG + Intergenic
1195020341 X:100820398-100820420 AAGCCGACTCAACAGAGCTATGG + Exonic
1195687710 X:107601310-107601332 AAGCCCACCCTGCAGAAGCAGGG + Exonic
1196684113 X:118496063-118496085 CCGGCCACTCACCAGCACCACGG - Exonic