ID: 951210261

View in Genome Browser
Species Human (GRCh38)
Location 3:19966917-19966939
Sequence CTGGACTACTTGGGAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951210261_951210266 -4 Left 951210261 3:19966917-19966939 CCTGTACCTCCCAAGTAGTCCAG 0: 1
1: 0
2: 1
3: 9
4: 192
Right 951210266 3:19966936-19966958 CCAGCGCATACCCCCATGCCTGG 0: 1
1: 1
2: 10
3: 263
4: 3250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951210261 Original CRISPR CTGGACTACTTGGGAGGTAC AGG (reversed) Intronic
901758541 1:11455975-11455997 CAGGGCTACTTGGTAGGTCCTGG - Intergenic
901930084 1:12591545-12591567 CTGGCCCGCTTGGGAGGCACAGG + Intronic
902219900 1:14958149-14958171 CTGGACTACTAGGGATCCACTGG - Intronic
902242881 1:15100439-15100461 CTGGTCTAAGTGGGAGGTGCAGG - Intronic
903246986 1:22023400-22023422 CTGAACTACTTGGGAGGCTAAGG + Intergenic
903904902 1:26678275-26678297 CTCGATTACTTGGGAGGTTGAGG - Intergenic
904633629 1:31862243-31862265 CTGAACTACTTGGGAGGCTGAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909757462 1:79244510-79244532 CCGGGCTACTTGGGAGGTTGAGG - Intergenic
912914931 1:113805230-113805252 CTGGGCTACTTGGGAGGCTGAGG - Intronic
914906810 1:151753054-151753076 CTCAGCTACTTGGGAGGTAGAGG - Intergenic
920883977 1:209908516-209908538 CTTAACTACTTGGGAGGTTGAGG - Intergenic
921759824 1:218900009-218900031 CAGAACTACTTTGGAGGTAAAGG + Intergenic
922508419 1:226141439-226141461 CTGAACTACTAGGGAGGCAGAGG - Intergenic
922782070 1:228260472-228260494 CTTGGCTACTTGGGAGGCTCAGG - Intronic
923653731 1:235897798-235897820 CTGGGCTACTTGGGAGGCTGAGG - Intergenic
924699983 1:246441725-246441747 CTCGGCTACTTGGGAGGCAGAGG - Intronic
1063285730 10:4685743-4685765 CTGGACTACTTTGGAAGTGTTGG + Intergenic
1064506192 10:16033254-16033276 CTTAGCTACTTGGGAGGTAGAGG + Intergenic
1065344314 10:24734360-24734382 CTGAGCTACTTGGGAGGCTCGGG - Intergenic
1065714209 10:28549012-28549034 CTCAACTACTTGGGAGGTTGTGG - Intronic
1066176289 10:32910852-32910874 CTCAACTACTTGGGAGGTTGAGG - Intronic
1069525740 10:69169320-69169342 CTTGAGTAGCTGGGAGGTACAGG + Intronic
1072514770 10:96169142-96169164 CTGGGCTATTTGGGAGGTTGTGG - Intronic
1072665899 10:97392084-97392106 CCCAACTACTTGGGAGGTAGAGG - Intronic
1073323953 10:102631841-102631863 CTGGAGTATTTGGGAGAGACTGG + Exonic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1081202323 11:40232120-40232142 CTCGGCTACTTGGGAGGTTGAGG - Intronic
1083474190 11:62905334-62905356 CTGGACTAGTTTGGAGGCAGTGG + Intergenic
1084490704 11:69476694-69476716 CTGGCCTAATTTGGAGGGACAGG - Intergenic
1091401062 12:181003-181025 CTGGGCTACTTGGGAGGCTGAGG - Intergenic
1091995399 12:4988985-4989007 CTGGACTACTTTGGTGGGCCAGG - Intergenic
1095574874 12:43725529-43725551 CTGGGCTACTTGGGAGGCTGAGG - Intergenic
1096007536 12:48184616-48184638 CTGGTCTCCTTGGGGGGGACGGG + Exonic
1096804852 12:54134356-54134378 ATGCACAACTTGGGAGGTAGTGG + Intergenic
1097140977 12:56902410-56902432 CTGGAGTGCTTGTGAGGGACTGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098730376 12:74029204-74029226 TTTGACTACTTGGGTGGTGCAGG - Intergenic
1099856632 12:88176657-88176679 CTCGGCTACTTGGGAGGCTCAGG + Intronic
1100897244 12:99197357-99197379 CTGGAGTTCTTGGGAGGGAATGG - Intronic
1102264928 12:111475226-111475248 CTGGGCTACTTGGGAGGCTGAGG + Intronic
1103809694 12:123603504-123603526 CTCAGCTACTTGGGAGGTTCAGG - Intronic
1104626311 12:130358541-130358563 CTGGGCTACTAGGGAGGGGCCGG - Intronic
1108336653 13:49449364-49449386 CTGGGCTACTTGGGAGGCTGAGG - Intronic
1111489029 13:88944801-88944823 CTGGTCTACTTGGGAGGCTGAGG + Intergenic
1111693245 13:91591982-91592004 GTGGACTTCTTTGGAGGTAAAGG + Intronic
1112366949 13:98763410-98763432 TTGGACGATTTGGGAGGTACAGG - Intergenic
1114043195 14:18698874-18698896 CTGGACTACTTGCCAGAGACAGG + Intergenic
1114047484 14:18889320-18889342 CTGGACTACTTGCCAGAGACAGG + Intergenic
1114116729 14:19630088-19630110 CTGGACTACTTGCCAGAGACAGG - Intergenic
1114478511 14:23015343-23015365 CTGAGCTACTCGGGAGGTAGAGG - Intergenic
1114857068 14:26461103-26461125 CTGGACCACTTGGTAGGCAAAGG - Intronic
1115911428 14:38260392-38260414 GTGGACTTCTTTGGAGGTAAGGG - Intergenic
1117064397 14:51995561-51995583 ATGGACATCTTGGGGGGTACAGG + Intronic
1118190055 14:63572162-63572184 TTGAACTACTTGGGAGGTGGAGG - Intergenic
1118368924 14:65119549-65119571 CTCAACTACTTGGGAGGTTGAGG + Intergenic
1119795677 14:77394729-77394751 CAGGACTACTTGAGAGATGCTGG + Exonic
1119839868 14:77784030-77784052 CTGAGCTACTTGGGAGGTTGAGG + Intergenic
1121248026 14:92477573-92477595 CTCAACTACTTGGGAGGTTGAGG - Intronic
1121665208 14:95666814-95666836 GTGGACCCCTTGGGAGGTGCTGG + Intergenic
1122606569 14:102950527-102950549 TTGGACTGCTCGGGAGGTATTGG + Exonic
1123219428 14:106842475-106842497 CTGGACAATTTGGGAGGTACAGG + Intergenic
1123425325 15:20166225-20166247 CTGGGCTACTTGGGAGGCTGAGG + Intergenic
1123534549 15:21172759-21172781 CTGGGCTACTTGGGAGGCTGAGG + Intergenic
1124506009 15:30274445-30274467 CAGGACTGCTGGGGAGGCACCGG + Intergenic
1124737544 15:32264187-32264209 CAGGACTGCTGGGGAGGCACCGG - Intergenic
1125595491 15:40882961-40882983 CTCAACTACTTGGGAGGTTGAGG - Intergenic
1127734965 15:61831444-61831466 AGGGACGACTTGGGAGCTACTGG + Intergenic
1128126458 15:65196874-65196896 CTGGGGTGCTTTGGAGGTACTGG + Exonic
1130932028 15:88436532-88436554 CCCGACTACTTGGGAGGTTGAGG - Intergenic
1135638004 16:24095427-24095449 CAGGACTAGTTGGCAGGTCCAGG + Intronic
1137442347 16:48508014-48508036 CTGGACAACCTGGGAGCTTCAGG - Intergenic
1142598907 17:1043612-1043634 GTGGACTACTTGGGAGGCTAAGG - Intronic
1148519735 17:48261389-48261411 CAGGAATCCTTGGGAGCTACAGG + Intronic
1148970659 17:51478365-51478387 CTTGGCTCCTTGGGAGGTGCAGG + Intergenic
1151697702 17:75726308-75726330 CTGGGCTACTTGGGAGGCTGAGG + Intronic
1155842125 18:30659035-30659057 CTGGACTACCTGTGAGGCAGGGG - Intergenic
1159890294 18:73946579-73946601 CAAGACTACATTGGAGGTACTGG + Intergenic
1159933266 18:74336628-74336650 CAAGAATATTTGGGAGGTACTGG - Intronic
1160039371 18:75332217-75332239 ATGGACTACTTGGGCTGTCCAGG + Intergenic
1162681432 19:12345802-12345824 CTTGACTACTTGGGAGGCTGAGG + Intergenic
1163230789 19:16000577-16000599 CTGGACAAGTTGGGAGGTATAGG + Intergenic
1165071740 19:33259777-33259799 CTGGAGTTCTTGGGAGGTGGAGG - Intergenic
1165594778 19:37003445-37003467 CTCAGCTACTTGGGAGGTTCAGG + Intergenic
927607941 2:24505300-24505322 CTGTACTACTTGGGAGGCTGAGG - Intronic
927775771 2:25901850-25901872 CTGAGCTACTTGGGAGGTTGAGG - Intergenic
930193885 2:48489383-48489405 CTCAACTACTTGGGAGGCTCAGG + Intronic
930655699 2:54005453-54005475 CCCAACTACTTGGGAGGCACAGG - Intronic
933642498 2:84778614-84778636 CCCAGCTACTTGGGAGGTACAGG - Intronic
938424863 2:131177848-131177870 CTGGACTACTTGCCAGAGACAGG + Intronic
938690455 2:133783746-133783768 CTTGACAATTTGGGAAGTACAGG - Intergenic
938783375 2:134605059-134605081 CTGAACTACTTGGGAGGCTGAGG + Intronic
941669453 2:168276540-168276562 CTGAACTACTTGGGAGGCTGTGG - Intergenic
942386208 2:175446049-175446071 CTGAAATACATTGGAGGTACAGG + Intergenic
944726684 2:202478486-202478508 TGGGACTACTTTGGAAGTACGGG - Intronic
948242803 2:236452416-236452438 CTGGATGACTTGGGGGGGACCGG - Intronic
1169346407 20:4831600-4831622 CTGTACTACTTGGGAGGCTGAGG + Intergenic
1169405851 20:5320465-5320487 CTCAACTACTTGGGAGGCAGAGG + Intergenic
1172138495 20:32704771-32704793 CTGGGTTATTTGGGTGGTACAGG - Intronic
1174212207 20:48888687-48888709 CTCAACTACTTGGGAGGTTGAGG + Intergenic
1176124183 20:63468128-63468150 CTGGACCCCTTGGGAGGTCTCGG - Intronic
1177835923 21:26186072-26186094 CTTAACTACTTGGGAGCTACTGG + Intergenic
1178385397 21:32144903-32144925 CTCAACTACTTGGGAGGTTGAGG - Intergenic
1180466018 22:15611991-15612013 CTGGACTACTTGCCAGAGACAGG + Intergenic
1182855040 22:33509564-33509586 CTGGGCTACTTGGGAGGCTGGGG - Intronic
1183060391 22:35333214-35333236 CTGGACTCCCTGGGAGGTTGGGG - Intronic
1183962806 22:41422312-41422334 CTGAGCTACTTGGGAGGTTGAGG + Intergenic
1183973942 22:41499218-41499240 CTGGACTACCTGGCACATACTGG - Intronic
1184675713 22:46041911-46041933 CTGGAGTAGCTGGGAGTTACAGG + Intergenic
1185312449 22:50163583-50163605 CTCAACTACTTGGGAGGTTGAGG - Intergenic
949751947 3:7362572-7362594 CTGGTCTACTTGATAGGTATTGG + Intronic
949832370 3:8229655-8229677 CTCAACTACTTGGGAGGTTGAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950172484 3:10848620-10848642 TTGGGCTCCTTGGGAGGTGCCGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950658909 3:14454334-14454356 CTGGGGTACTTAGGAGGCACAGG + Intronic
951210261 3:19966917-19966939 CTGGACTACTTGGGAGGTACAGG - Intronic
954312357 3:49779799-49779821 CTCGGCTACTTGGGAGGCAGGGG - Intronic
956134818 3:66088429-66088451 CTCAGCTACTTGGGAGGTAGAGG - Intergenic
962722962 3:138193374-138193396 CTGAGCTACTTGGGAGGCAGAGG - Intronic
962792058 3:138820607-138820629 CTGAACTACTTGGGAGGCCGAGG - Intronic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
964994822 3:162866066-162866088 CTGTACTTAGTGGGAGGTACGGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967210036 3:187160169-187160191 AAGGACAACTTGGGAGGTAAGGG + Intronic
968476352 4:811113-811135 CTGAACTACTTGGGAGGCAGAGG - Intronic
972479865 4:39486928-39486950 CTGGACAATTTGGGAGGTATAGG - Intergenic
972609617 4:40644528-40644550 CTCAACTACTTGGGAGGTTGAGG + Intergenic
974977018 4:68904562-68904584 CTGGACAATTTAGGAGGTATAGG + Intergenic
975048300 4:69829666-69829688 CTGGACAATTTGGAAGGTATAGG + Intronic
976657877 4:87508309-87508331 CTCAACTACTTGGGAGGTTGAGG - Intronic
978577284 4:110199621-110199643 TTGGACTACTGGGGAGGTGGGGG - Intergenic
979427181 4:120582471-120582493 CTGAACTACTTGGGAGGCTGGGG - Intergenic
984400956 4:179262721-179262743 CTCAACTACTTGGGAGGCAGGGG - Intergenic
984605880 4:181785739-181785761 CTGAAATACTTGGGAACTACAGG - Intergenic
986166209 5:5273405-5273427 CTCAACTACTTGGGAGGGAGAGG + Intronic
986331630 5:6720558-6720580 CAGGACTACTCGGGAGGCAGAGG + Intronic
988511090 5:31865426-31865448 CCCAACTACTTGGGAGGTTCAGG - Intronic
989066413 5:37467109-37467131 CTGAGCTACTTGGGAGGTTGAGG + Intronic
990009368 5:50977493-50977515 CTCTTGTACTTGGGAGGTACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990807175 5:59677744-59677766 CTGGATTACTTGGTTGGTGCTGG - Intronic
991109030 5:62876616-62876638 CTGTACTACTTGGGAGGCTGAGG + Intergenic
993085178 5:83355095-83355117 CTGGCCTACTTGAGAGGCAAGGG - Intergenic
993868448 5:93221779-93221801 ATGGCTCACTTGGGAGGTACTGG + Intergenic
994282072 5:97917247-97917269 CTGAACTACTTGGGAGGCTGAGG - Intergenic
995424818 5:112008773-112008795 CTGGGCTACTTGGGAGGCTGAGG - Intergenic
1000778012 5:165443132-165443154 CTGAGCTACTTGGGAGGTTGAGG + Intergenic
1007867844 6:44993045-44993067 CTCAACTACTTGGGAGGCTCAGG + Intronic
1012373060 6:98530179-98530201 CTGGAGTGCTTGGGTGGGACTGG - Intergenic
1013412087 6:109891622-109891644 CTGGGCAATTTGGGAGTTACAGG + Intergenic
1013634405 6:112015718-112015740 CTGGACAACTAGGGAGGTTTAGG - Intergenic
1016561255 6:145397323-145397345 CTCGGTTACTTGGGAGGTAGAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018406181 6:163484994-163485016 CTGTATTACTTGGGAGATTCAGG + Intronic
1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG + Intronic
1024247345 7:47480243-47480265 CTGCCCTACTTGAGAAGTACAGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027372728 7:77523208-77523230 CTCAACTACTTGGGAGGTTGAGG + Intergenic
1027781244 7:82523065-82523087 CTGTGCTACTTGGGAGGTTGAGG + Intergenic
1030856191 7:114560498-114560520 CTCAACTACTTGGGAGGCAGAGG + Intronic
1031450772 7:121915237-121915259 CTGTATTATTTGGGAGGTTCAGG + Intronic
1031814597 7:126417829-126417851 CTGGAACCCTTGGGAGGTATAGG - Intergenic
1031931318 7:127688604-127688626 CTCAACTACTTGGGAGGTAGAGG + Intronic
1032648235 7:133849302-133849324 CTGAGCTACTTGGGAGGTTGAGG + Intronic
1033013421 7:137646456-137646478 CTTGTCTACTTGGGAGGAAGAGG - Intronic
1033109652 7:138562934-138562956 CTGGGCAATTTGGGAGGTACAGG + Intronic
1034400987 7:150861229-150861251 CTGGGCTTCCTGGGAGGAACTGG - Exonic
1038782485 8:30580059-30580081 CAGGACTGCTTGGGAGGAGCTGG + Intronic
1038788179 8:30641476-30641498 CTCGGCTACTTGGGAGGCTCAGG - Intronic
1038794499 8:30697802-30697824 CTTGGCTACTTGGGAGGCTCAGG - Intronic
1041107059 8:54454188-54454210 CTGCCCTACCTGGGAGGTGCGGG + Intergenic
1044257672 8:90084271-90084293 CTGAACTACTTGGGAGGCTGAGG + Intronic
1045052555 8:98340402-98340424 CAGGACTACTTGTGAAGTTCTGG + Intergenic
1045270584 8:100657753-100657775 GTGGACTACTTGGGAGGCTGAGG + Intronic
1047505416 8:125475754-125475776 CTGCACTGGTTGGGAGGGACAGG - Intergenic
1047832683 8:128653588-128653610 CTGGTTGACTTGGGAGGTAGTGG - Intergenic
1048314626 8:133352882-133352904 ATGGACTCCCTGGGAGGCACGGG - Intergenic
1051633705 9:19163026-19163048 CTCAACTACTTGGGAGGCAGAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053154006 9:35761556-35761578 CTCGGCTACTTGGGAGGCTCAGG + Intergenic
1055441457 9:76340527-76340549 CTCAACTACTTGGGAGGTTGAGG + Intronic
1055465860 9:76565125-76565147 CTCAACTACTTGGGAGGTTGAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056907133 9:90662765-90662787 CTGGGCTACTTGGGAGGCTGAGG - Intergenic
1057583484 9:96308433-96308455 CTGTACTACTTGGGAGGCTGAGG + Intergenic
1058947606 9:109873318-109873340 CTGGGCTACTTGGGAGGCTGAGG + Intronic
1185551461 X:985490-985512 CTTGGCTACTTGGGAGGCTCAGG - Intergenic
1185554202 X:1007615-1007637 CTGAGCTACTTGGGAGGTTGAGG + Intergenic
1186729418 X:12392535-12392557 CCGGACTACTTGGGAGGCTGAGG + Intronic
1186949567 X:14608497-14608519 CTGTACTACTTTGGAGGAAATGG + Intronic
1187866837 X:23730520-23730542 CTTGACAGCTTGGGAGGTACTGG - Exonic
1190704737 X:53017854-53017876 CTTGGCTACTTGGGAGGTGGAGG - Intergenic
1190893523 X:54592697-54592719 CCCAACTACTTGGGAGGTTCAGG + Intergenic
1193549993 X:82879827-82879849 CTGGACGAATTTGGAGGTAAGGG - Intergenic
1201252740 Y:12075540-12075562 CTGTATTAACTGGGAGGTACAGG + Intergenic
1201848764 Y:18453058-18453080 CTGAGCTACTTGGGAGGCAAAGG + Intergenic
1201884554 Y:18867317-18867339 CTGAGCTACTTGGGAGGCAAAGG - Intergenic
1202168310 Y:22015438-22015460 CTGAGCAACTTGGGAGGTATAGG - Intergenic
1202223051 Y:22570930-22570952 CTGAGCAACTTGGGAGGTATAGG + Intergenic
1202320064 Y:23624730-23624752 CTGAGCAACTTGGGAGGTATAGG - Intergenic
1202550704 Y:26045326-26045348 CTGAGCAACTTGGGAGGTATAGG + Intergenic