ID: 951216316

View in Genome Browser
Species Human (GRCh38)
Location 3:20028746-20028768
Sequence GCCACCCTGCCCCACCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951216310_951216316 13 Left 951216310 3:20028710-20028732 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG No data
951216314_951216316 4 Left 951216314 3:20028719-20028741 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG No data
951216312_951216316 7 Left 951216312 3:20028716-20028738 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG No data
951216315_951216316 3 Left 951216315 3:20028720-20028742 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG No data
951216308_951216316 16 Left 951216308 3:20028707-20028729 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 951216316 3:20028746-20028768 GCCACCCTGCCCCACCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951216316 Original CRISPR GCCACCCTGCCCCACCATGA AGG Intergenic
No off target data available for this crispr