ID: 951217726

View in Genome Browser
Species Human (GRCh38)
Location 3:20040497-20040519
Sequence TGCCCCGCAGCCGCCCGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1344
Summary {0: 2, 1: 0, 2: 7, 3: 125, 4: 1210}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951217726_951217732 -9 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217732 3:20040511-20040533 TGCGGGGCAGGAGCCGGGGCAGG 0: 1
1: 3
2: 13
3: 170
4: 1296
951217726_951217744 26 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217744 3:20040546-20040568 GGCGCTGCCCCCGCAGCCTGCGG 0: 1
1: 0
2: 3
3: 28
4: 318
951217726_951217739 4 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217739 3:20040524-20040546 CCGGGGCAGGGGCCGGGCCCGGG 0: 1
1: 3
2: 114
3: 379
4: 2074
951217726_951217734 -7 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217734 3:20040513-20040535 CGGGGCAGGAGCCGGGGCAGGGG 0: 1
1: 1
2: 21
3: 399
4: 1688
951217726_951217737 3 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217737 3:20040523-20040545 GCCGGGGCAGGGGCCGGGCCCGG 0: 1
1: 10
2: 176
3: 779
4: 3235
951217726_951217733 -8 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217733 3:20040512-20040534 GCGGGGCAGGAGCCGGGGCAGGG 0: 1
1: 0
2: 16
3: 198
4: 1562
951217726_951217735 -3 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217735 3:20040517-20040539 GCAGGAGCCGGGGCAGGGGCCGG 0: 1
1: 6
2: 156
3: 693
4: 2883
951217726_951217740 5 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217740 3:20040525-20040547 CGGGGCAGGGGCCGGGCCCGGGG 0: 1
1: 2
2: 115
3: 345
4: 1738
951217726_951217736 -2 Left 951217726 3:20040497-20040519 CCGGGCCGGGCGGCTGCGGGGCA 0: 2
1: 0
2: 7
3: 125
4: 1210
Right 951217736 3:20040518-20040540 CAGGAGCCGGGGCAGGGGCCGGG 0: 1
1: 1
2: 31
3: 435
4: 1887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951217726 Original CRISPR TGCCCCGCAGCCGCCCGGCC CGG (reversed) Exonic
900104522 1:976670-976692 GGCCCCGCACACGCCCGCCCCGG + Intronic
900105188 1:978112-978134 TGCCCCGCACACGGCCGCCCCGG + Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900263650 1:1746250-1746272 TGCACTGCAGCGGCCCGGGCTGG - Intergenic
900346641 1:2213499-2213521 TGCCCCGGTGCAGCCTGGCCTGG - Intergenic
900428651 1:2591973-2591995 GGACCAGCAGCTGCCCGGCCTGG - Exonic
900483772 1:2911805-2911827 TCCCCCGCAGCCCCCAAGCCTGG - Intergenic
900612602 1:3550712-3550734 TGCCCAGCAGCCACCCAACCGGG + Intronic
901066450 1:6496901-6496923 TTCCCCCCAGCAGCCCTGCCGGG - Intronic
901242641 1:7704259-7704281 CGCCCCGCGCCCGCCCTGCCTGG - Intronic
901734789 1:11305700-11305722 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
902896945 1:19485587-19485609 TTCCCCGCCCCGGCCCGGCCCGG + Intergenic
903128401 1:21262881-21262903 TGCCTGGCAACCGCCAGGCCGGG + Intronic
903190142 1:21651826-21651848 GCCGCCGCCGCCGCCCGGCCCGG + Exonic
903458375 1:23504226-23504248 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
903468391 1:23568174-23568196 TGTCCCGCAGCTGCGCGTCCGGG - Intergenic
903485874 1:23689025-23689047 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
903485885 1:23689065-23689087 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
903519415 1:23935739-23935761 CGCCCGGCAGCCACCCGGTCTGG + Intergenic
903531207 1:24032076-24032098 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
903748439 1:25603977-25603999 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
903867660 1:26410839-26410861 GGGCCAGCAGCCGCCCGACCAGG + Exonic
903894758 1:26596274-26596296 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
903894769 1:26596314-26596336 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
904237691 1:29124944-29124966 GGTCCCGGAGCCGCACGGCCAGG + Intergenic
904473267 1:30748690-30748712 CACTCCGCAGCAGCCCGGCCTGG + Intronic
904641911 1:31937848-31937870 TCCCCCGCCCCGGCCCGGCCCGG + Intronic
904760993 1:32804431-32804453 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
904782972 1:32964484-32964506 TGCGCAGCCGCCGCCCGCCCCGG - Exonic
904831653 1:33309541-33309563 CGCCCGGCAGCCGCCCCACCTGG - Intronic
904930348 1:34082347-34082369 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
904930365 1:34082387-34082409 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
905527072 1:38647566-38647588 CGCCCGGCAGCCGCCCCGTCAGG + Intergenic
905680857 1:39869823-39869845 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
906136168 1:43502082-43502104 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
906210814 1:44011350-44011372 TCCCCCGCAGTCGCCTGCCCAGG - Intronic
906308786 1:44738569-44738591 TGCCCCGCCGCCACCCTGTCTGG + Intergenic
906308805 1:44738646-44738668 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
906356978 1:45115376-45115398 CGCCCAGCAGCCGCCCAGTCTGG - Intronic
907009837 1:50952825-50952847 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
907216625 1:52869983-52870005 CACCCGGCAGCCGCCCCGCCCGG - Intronic
907216736 1:52870448-52870470 TGCCCGGCCGCCGCCCTGTCTGG - Intronic
907223019 1:52921242-52921264 GGCCCCGCGGCCCCCAGGCCAGG - Intronic
907425874 1:54379006-54379028 GGCCCCGCCACCGCCTGGCCAGG + Intronic
907540975 1:55215241-55215263 TGCTCCGCAGCAGCCGGGCCAGG + Intergenic
910145652 1:84077840-84077862 TCCCCCGCGGTCGCCCGGGCTGG - Intergenic
910406927 1:86899706-86899728 CGCCCAGCAGCCGCCCTGTCCGG - Intronic
910412719 1:86963913-86963935 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
910673743 1:89797893-89797915 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
910891654 1:92026124-92026146 CGCCCGGCAGCCGCCCAGTCTGG - Intergenic
911569791 1:99508381-99508403 TGCCCGGCAACCGCCCTGTCTGG + Intergenic
911647579 1:100352657-100352679 TGCTCCGCCGCCGCCGCGCCTGG - Exonic
912116297 1:106412553-106412575 TGCCCAGCAGCTGCCCCGTCTGG + Intergenic
912266169 1:108160155-108160177 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
912355675 1:109053058-109053080 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
912371468 1:109177255-109177277 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
912764450 1:112396183-112396205 GCCCCCTCAGCCGCCCGGCGGGG - Exonic
913022815 1:114804609-114804631 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
913071460 1:115302762-115302784 TGTGCCGCAGCCACCAGGCCTGG + Intronic
914230963 1:145764597-145764619 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
914230987 1:145764677-145764699 TGCCCAGCAGCCACTCGGTCCGG + Intronic
914374581 1:147061964-147061986 TGCCCTGCAGCCACCCCGTCTGG + Intergenic
914392178 1:147233256-147233278 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
914468310 1:147950092-147950114 TGCCCGGCAGCCACCCCGTCCGG - Intronic
914758452 1:150579756-150579778 GGCCCCGCCCCGGCCCGGCCGGG - Intergenic
914787973 1:150851082-150851104 CGCCCCGCAGCCGCCCCGTCCGG + Intronic
914787986 1:150851122-150851144 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
914893844 1:151651440-151651462 TGCCCGGCAGCCGCCCCATCTGG - Intronic
914953946 1:152144876-152144898 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
914953957 1:152144916-152144938 TGCCCAGCAGCCACCCCGTCTGG - Intergenic
914959837 1:152196259-152196281 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
914965789 1:152256281-152256303 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
914987342 1:152472092-152472114 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
915208408 1:154287757-154287779 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
915861562 1:159449913-159449935 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
915861572 1:159449953-159449975 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
916037326 1:160933341-160933363 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
916037439 1:160933625-160933647 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
916050028 1:161029645-161029667 TGCCCCGCCGCCACCCCGTCTGG + Intronic
916050049 1:161029718-161029740 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
916087486 1:161281625-161281647 TGCCCGGCAGCCACCCCGTCCGG - Intronic
916106900 1:161439789-161439811 GGCCCCTCAGCCACCCGGCTTGG + Intergenic
916131646 1:161616643-161616665 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
916324900 1:163546027-163546049 TGCCCGGCCGCCACCCGGTCTGG - Intergenic
916800003 1:168207806-168207828 CGCCCGGCAGCCGCCCGTCTGGG - Intergenic
916864123 1:168837433-168837455 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
917006210 1:170419130-170419152 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
917126565 1:171693738-171693760 TGCCCTGCCGCCGCCCTGTCCGG - Intergenic
917553311 1:176058052-176058074 CGCCCGGCAGCCGCCCCGGCCGG + Intronic
918022730 1:180710889-180710911 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
918022740 1:180710929-180710951 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
918812495 1:189139853-189139875 TGCCTGGCAGCCGCCCCGTCTGG - Intergenic
918818824 1:189225848-189225870 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
918818849 1:189225925-189225947 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
919423903 1:197405874-197405896 CGCCCCGCAGCCACCCCGTCTGG + Intronic
920143889 1:203841798-203841820 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
920451523 1:206064189-206064211 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
920451533 1:206064229-206064251 TGCCCGGCAGCCACCCCGTCCGG + Intronic
920452481 1:206070228-206070250 TGCCCCTCACCCGCCTGGCAGGG + Intronic
920704909 1:208243876-208243898 CGCCCCGCAGCAGCCCGGCTGGG + Exonic
921192836 1:212725114-212725136 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
921238374 1:213152438-213152460 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
921638444 1:217524097-217524119 TGCCCGGCAGCCACCCCGTCTGG - Intronic
921814071 1:219545840-219545862 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
922102475 1:222487836-222487858 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
922102486 1:222487876-222487898 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
922306525 1:224349903-224349925 CGCCCAGCAGCCGCCCCGTCTGG - Intergenic
922306610 1:224350251-224350273 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
922338222 1:224634858-224634880 TGCCCCGCTGCATCCCCGCCAGG + Intronic
922644895 1:227276379-227276401 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
922644957 1:227276547-227276569 TGCCCAGCCGCCGCCCCGTCTGG + Intronic
922749453 1:228063759-228063781 TGCCCAGCCGCCTCCCGGCTGGG - Intergenic
922831750 1:228557754-228557776 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922832230 1:228609736-228609758 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922832790 1:228611977-228611999 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922833351 1:228614218-228614240 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922833911 1:228616459-228616481 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922834468 1:228618700-228618722 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922835579 1:228623135-228623157 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922836137 1:228625377-228625399 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922836695 1:228627616-228627638 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922837254 1:228629858-228629880 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922837815 1:228632099-228632121 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922838373 1:228634339-228634361 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922838931 1:228636564-228636586 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922839491 1:228638805-228638827 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922840052 1:228641036-228641058 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922840612 1:228643277-228643299 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
922841175 1:228645508-228645530 CGCCTCGCCGCCGCCCCGCCAGG - Intergenic
923468245 1:234267654-234267676 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
923589925 1:235309392-235309414 TGCCCGGCAGCCACCCGTCCGGG + Intronic
923793029 1:237127623-237127645 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
923901085 1:238327105-238327127 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
924117522 1:240762627-240762649 TCCTCCGCAGCCGCCGGCCCGGG - Intergenic
924192252 1:241566160-241566182 TGCCCCACAGCACTCCGGCCTGG + Intronic
924482785 1:244451929-244451951 GGCCCCGCCCCCGCCCCGCCGGG + Exonic
924824150 1:247522177-247522199 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
924925609 1:248676905-248676927 TGCCTGGCAGCCGCCCCGTCCGG + Intergenic
924943736 1:248830411-248830433 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1063084763 10:2806567-2806589 TGCCCGGCCGCCGCCCCGTCTGG - Intergenic
1063776717 10:9273257-9273279 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1064070730 10:12226455-12226477 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1065055340 10:21837668-21837690 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1065055353 10:21837708-21837730 TGCCTGGCAGCCGCCCCGTCCGG + Intronic
1065738070 10:28771973-28771995 TGCCCTGCAGCCGCCCAGTCTGG + Intergenic
1065738079 10:28772013-28772035 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1066026017 10:31361670-31361692 TGCCCAGCCGCCGCCCTGTCTGG - Intronic
1066115262 10:32233629-32233651 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1066325356 10:34353062-34353084 CGCCCCGCAGCTGCCCTGTCTGG + Intronic
1066325368 10:34353102-34353124 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
1066390929 10:34976753-34976775 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1066432281 10:35363178-35363200 TGCCCAGCTGCCGCCCCGTCGGG - Intronic
1066952893 10:42138260-42138282 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1067120041 10:43465306-43465328 CGCCCGGCAGCCACCCGGTCCGG - Intronic
1067339791 10:45391916-45391938 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1067872059 10:49970590-49970612 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1067872121 10:49970723-49970745 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
1067912065 10:50355914-50355936 TGCCCCGCCGCCACCCTGTCTGG + Intronic
1068536387 10:58244457-58244479 TGCCCGGCCGCCGCCCCGTCTGG + Intronic
1068673227 10:59744343-59744365 TGCCCCGCCGCCACCCGTCTGGG + Intergenic
1068673308 10:59744581-59744603 TGCCCAGCCGCCACCCGGTCTGG + Intergenic
1068910448 10:62374135-62374157 TGCCCCCCCGCCACCCAGCCGGG - Intergenic
1069052673 10:63811592-63811614 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1069157780 10:65052225-65052247 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1069424832 10:68279647-68279669 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1069674656 10:70238942-70238964 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
1069674794 10:70239436-70239458 TGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1069674815 10:70239513-70239535 TGCCCAGCAGCCACCCCGTCTGG - Intergenic
1069674954 10:70240009-70240031 TGCCCGGCAGCCACCCTGTCTGG - Intergenic
1069674973 10:70240086-70240108 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1069733013 10:70631343-70631365 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1070111972 10:73495648-73495670 TGCCCAGCAGGGGCCCGCCCAGG + Intronic
1070367325 10:75750228-75750250 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1070629684 10:78075982-78076004 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1070807519 10:79279202-79279224 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1071311463 10:84347655-84347677 CGCCCGGCAGCCGCCCGTCTGGG - Intronic
1071538314 10:86454953-86454975 CGCCCGGCAGCCGCCCGGTCTGG + Intronic
1071546781 10:86535624-86535646 TGCGCCGCAGCCGCCCTGCCCGG + Intergenic
1071563982 10:86662261-86662283 TGCCCAGCACCTGCCCTGCCTGG + Exonic
1072180336 10:92975443-92975465 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1072180379 10:92975534-92975556 AGCCCCCCAGCCGCCCCGTCCGG + Intronic
1072480964 10:95809628-95809650 TGCCCGGCATCCGCCCCGTCTGG - Intronic
1072481054 10:95809902-95809924 TGCCCGGCAGCTGCCCCGTCTGG - Intronic
1072710790 10:97714468-97714490 TCCCCCGCCGCCGCCCCGCGCGG + Exonic
1073036870 10:100570053-100570075 CCCGCCGCAGCCGCCCGCCCTGG - Intergenic
1073082800 10:100870618-100870640 GGTCCTGCAGCAGCCCGGCCTGG - Intergenic
1073274850 10:102301503-102301525 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1074008940 10:109457041-109457063 TGCCCCGCCGCGGCCCGACTTGG - Intergenic
1074152136 10:110767407-110767429 TGCCCGGCAGCCACCCCGTCCGG - Intronic
1074814582 10:117134653-117134675 AGCCCCGGAGCCGCGCGCCCCGG - Intronic
1075013800 10:118895688-118895710 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1075013810 10:118895728-118895750 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1075050983 10:119182358-119182380 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1075054473 10:119207419-119207441 AGCCCCGGCGCCGCGCGGCCGGG + Intergenic
1075108522 10:119559600-119559622 TGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1075108532 10:119559640-119559662 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1075243391 10:120798699-120798721 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1075407312 10:122203476-122203498 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1076011782 10:126994996-126995018 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1076049773 10:127323253-127323275 TTCCCCGTGGCCGCCCTGCCTGG + Intronic
1077014154 11:392604-392626 TGCCCCGCACGCGCCGGGCCAGG + Intronic
1077183916 11:1228182-1228204 GGCCCCGCAGCCGGCAGCCCTGG + Intronic
1077360396 11:2138121-2138143 AGCCCCGCAGGCCCCGGGCCGGG + Intronic
1077422650 11:2460244-2460266 CGCCCTGCAGCCACCCTGCCCGG - Intronic
1077495423 11:2884634-2884656 GGCCCCGCCCCGGCCCGGCCCGG - Intronic
1077680762 11:4237928-4237950 CACCCAGCAGCCGCCCTGCCTGG + Intergenic
1077685052 11:4283366-4283388 CGCCCAGCAGCCGCCCCTCCTGG + Intergenic
1077690136 11:4334564-4334586 CGCCCAGCAGCCGCCCCTCCTGG - Intergenic
1078067940 11:8090142-8090164 GGCCCCGGAGCCGGCGGGCCCGG + Exonic
1078122430 11:8523592-8523614 TGCCCGGCAGCCTCCCCGTCTGG + Intronic
1079018350 11:16888192-16888214 TGCCCAGCAGCCGCCCCATCTGG + Intronic
1079039894 11:17050747-17050769 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1079090460 11:17476852-17476874 TGCAGCTCCGCCGCCCGGCCCGG + Intergenic
1079122558 11:17696031-17696053 AGCCCTGCGGCCGCCCCGCCAGG - Intergenic
1079173943 11:18121296-18121318 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1079372009 11:19860229-19860251 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1079430941 11:20387814-20387836 GGCCCCACAGCGGCGCGGCCTGG - Intronic
1080538397 11:33243843-33243865 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1080635642 11:34121012-34121034 AGCCCCTCAGCCTCCCTGCCAGG - Intronic
1081796499 11:45824121-45824143 TGCGCCGCAGCTGCCCATCCAGG + Intergenic
1081807150 11:45896846-45896868 GGCCCCGCAGCCCCCCGGCCGGG + Intronic
1081915113 11:46725842-46725864 TGCCCCTCACCCACCAGGCCAGG + Exonic
1082065069 11:47892969-47892991 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1082166351 11:48955476-48955498 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1082233626 11:49798142-49798164 TGCCCGGCTGCCGCCCTGTCCGG - Intergenic
1082233695 11:49798312-49798334 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1082233753 11:49798444-49798466 CGCCCGGCAGCCGCCCCGACCGG - Intergenic
1082678841 11:56143903-56143925 TGCCTGGCAGCCGCCCCGTCCGG + Intergenic
1082706299 11:56497493-56497515 CGCCCAGCAGCCACCCCGCCCGG + Intergenic
1082871000 11:57943872-57943894 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1083042276 11:59699803-59699825 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1083154617 11:60815347-60815369 TGCCCGGCAGCCACCCTGTCTGG + Intergenic
1083246280 11:61430208-61430230 ATCCCCGCTGCCGCCCGCCCCGG - Intronic
1083303808 11:61752691-61752713 GGCCCCGCTACAGCCCGGCCCGG - Exonic
1083571232 11:63763262-63763284 TCCCCCGTCTCCGCCCGGCCCGG + Exonic
1083648511 11:64186574-64186596 TGGCCCGCAGCCGCCCCCTCGGG - Intronic
1083917988 11:65762838-65762860 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1084086189 11:66856465-66856487 CACCCCGCAGCAGCCCTGCCAGG + Intronic
1084557161 11:69882002-69882024 TCCCCAGCAGCAGCCTGGCCAGG - Intergenic
1084836140 11:71803115-71803137 GGCCACGCAGCCACACGGCCTGG + Intergenic
1084839212 11:71831465-71831487 TGCCCGGCAGCCGCCCCATCCGG + Intergenic
1084989530 11:72909829-72909851 TGCCCGGCAGCCGCCCCATCTGG + Intronic
1084989541 11:72909869-72909891 TGCCCGGCAGCCGCCCCATCTGG + Intronic
1085097817 11:73775218-73775240 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1085360098 11:75877978-75878000 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1085360122 11:75878059-75878081 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1085492486 11:76933846-76933868 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1085609458 11:77933748-77933770 CGCCCAGCAGCCGCCCGTCTGGG + Intronic
1085609467 11:77933787-77933809 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1085609496 11:77933864-77933886 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1085716657 11:78879260-78879282 TGCCTGGCAGCCGCCCTGTCTGG + Intronic
1085716686 11:78879377-78879399 TGCCTGGCAGCCGCCCTGTCTGG + Intronic
1085791302 11:79499935-79499957 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1085791325 11:79500012-79500034 CGCCCGGCAGCCGCCCAGTCTGG + Intergenic
1086017251 11:82182120-82182142 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1086122595 11:83316961-83316983 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1086366087 11:86110776-86110798 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1086366098 11:86110816-86110838 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1086434832 11:86770740-86770762 CGCCCCGCAGCCGCCCCGTCTGG - Intergenic
1086881492 11:92157686-92157708 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1087487018 11:98770113-98770135 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1088677198 11:112206111-112206133 TGCCCAGCTGCCGCCCGTCTAGG - Intronic
1089073589 11:115719403-115719425 TGCCCCGCACCTGCCCTCCCTGG + Intergenic
1089148470 11:116347188-116347210 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1089148484 11:116347228-116347250 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1089148507 11:116347308-116347330 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1089510135 11:118991676-118991698 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1089510149 11:118991716-118991738 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1089585633 11:119508041-119508063 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1090152777 11:124403351-124403373 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1090686698 11:129129344-129129366 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1090686712 11:129129384-129129406 CGCCCGGCAGCCGCCCAGTCCGG + Intronic
1090832333 11:130428197-130428219 TGGCCCGCGGCGCCCCGGCCCGG - Exonic
1091777040 12:3191375-3191397 TGCCCAGCTGCCCCCCTGCCAGG + Intronic
1092296049 12:7200128-7200150 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1092331466 12:7590303-7590325 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1092365444 12:7873097-7873119 TCCCCAGCAGCCGCCGGGGCTGG - Intronic
1092383652 12:8018978-8019000 TCCCCTGCAGCCGCCAGGGCTGG - Intergenic
1092453573 12:8625233-8625255 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1092849973 12:12618189-12618211 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1092849984 12:12618229-12618251 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1092849995 12:12618269-12618291 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1092850089 12:12618618-12618640 TGCCCGGCCGCCACCCCGCCTGG - Intronic
1094536082 12:31324164-31324186 GGCCCCGCGCCAGCCCGGCCCGG + Intronic
1095281084 12:40353141-40353163 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1095452766 12:42350045-42350067 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
1095452785 12:42350085-42350107 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1095452804 12:42350125-42350147 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1095571096 12:43685247-43685269 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1096225000 12:49861106-49861128 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1096647642 12:53047339-53047361 CGCCGCGCCCCCGCCCGGCCGGG + Intronic
1096856648 12:54488402-54488424 CGCCCGGCAGCCACCCGTCCGGG - Intergenic
1096951626 12:55479275-55479297 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1096968652 12:55648357-55648379 CGCCCGGCAGCCGCCCCGTCGGG - Intergenic
1096968663 12:55648397-55648419 CGCCCGGCAGCCGCCCAGTCTGG - Intergenic
1096983606 12:55743114-55743136 GCCCCCCCAGCCGCCCGCCCCGG + Intergenic
1097218354 12:57431108-57431130 TGCCCCTCAGCAGCCCTGCGGGG + Intergenic
1097779557 12:63686915-63686937 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1098018974 12:66134799-66134821 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1098021472 12:66160786-66160808 TGCCCGGCCGCCGCCCTGTCTGG - Intronic
1098021520 12:66160990-66161012 TGACCCGCCGCTGCCCGGTCTGG - Intronic
1098333150 12:69375218-69375240 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1098370923 12:69759718-69759740 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1098370966 12:69759811-69759833 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1098379419 12:69853186-69853208 TGCCCGGCAGCTGCCCCGTCCGG - Intronic
1099971363 12:89503916-89503938 CGCCCCGCAGCCACCCTGTCTGG + Intronic
1099971374 12:89503956-89503978 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1100048206 12:90411134-90411156 TGCCCCGCCGCCACCCCGCCTGG + Intergenic
1100507592 12:95235774-95235796 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1100577597 12:95907599-95907621 CGCCCGGCAGCCACCCGTCCGGG - Intronic
1100577609 12:95907639-95907661 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1100962216 12:99975107-99975129 TGCACCACAGCACCCCGGCCTGG + Intronic
1101885225 12:108656257-108656279 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1102025810 12:109713913-109713935 CGCCCCACAGGCGCCGGGCCCGG - Intergenic
1102089274 12:110172911-110172933 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1102323293 12:111957308-111957330 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1102578515 12:113872362-113872384 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1102656286 12:114484932-114484954 TGTCCTGCAGCCGCCCCGTCTGG - Intergenic
1103045421 12:117731345-117731367 CGCCCAGCAGCCGCCCTGTCTGG + Intronic
1103045430 12:117731385-117731407 CGCCCAGCAGCCGCCCCGTCCGG + Intronic
1103776832 12:123372209-123372231 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1103779448 12:123389235-123389257 CGCCCTCCCGCCGCCCGGCCCGG - Intronic
1103899339 12:124295343-124295365 CGCCCCGCCGCCGCCTGCCCCGG + Intronic
1104401650 12:128481381-128481403 GGCCCCAAAGCCGTCCGGCCTGG - Intronic
1104951917 12:132444985-132445007 TGCCCCACAGCAGGCAGGCCCGG + Intergenic
1105267636 13:18836599-18836621 TGCCCGGCAGCTGCCCCGTCTGG - Intergenic
1105437757 13:20391773-20391795 TGCCCCGCATCACCCCTGCCTGG + Intergenic
1105555954 13:21448079-21448101 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1105555978 13:21448159-21448181 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1105976806 13:25480314-25480336 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1106087678 13:26557880-26557902 CCCCCGACAGCCGCCCGGCCCGG - Intronic
1106104779 13:26723984-26724006 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1106157567 13:27171984-27172006 TGCCAGGCAGCGGCGCGGCCAGG + Intergenic
1106308307 13:28532521-28532543 TGCGCAGCCGCCACCCGGCCTGG - Intergenic
1106747614 13:32721322-32721344 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1107042836 13:35967221-35967243 TGCCCGGCCGCCGCCCCGTCTGG + Intronic
1107493104 13:40900546-40900568 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1107737764 13:43416642-43416664 TGCCCCGCCACCACCCGGTCTGG - Intronic
1108370339 13:49762036-49762058 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1108618524 13:52159237-52159259 TGCCCCGCGGGCGCCGGCCCCGG - Intronic
1108685888 13:52818229-52818251 TGCCCGGCAGCCGCCTCGTCTGG + Intergenic
1110436309 13:75481540-75481562 CGCCCCGCAGCCGCCCGCCTCGG + Exonic
1110558402 13:76885737-76885759 GGCGCCCCAGCAGCCCGGCCCGG - Exonic
1110626362 13:77660128-77660150 TGCCCAGCCGCCGCCCTGTCTGG - Intergenic
1110860512 13:80341031-80341053 GCCCCCGCGCCCGCCCGGCCCGG - Intergenic
1111388641 13:87561894-87561916 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1112070566 13:95845732-95845754 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1112077264 13:95928393-95928415 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1112344231 13:98576926-98576948 TGAGCCCCCGCCGCCCGGCCGGG - Intronic
1113194000 13:107782850-107782872 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1113655915 13:112067735-112067757 GCCCCCGCCGCCGCCCGCCCCGG - Exonic
1113872220 13:113566255-113566277 AGCCCCGCTGTCGCCCGCCCCGG - Intergenic
1114137260 14:19866509-19866531 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1114137340 14:19866745-19866767 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1114174790 14:20310140-20310162 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1114191596 14:20443272-20443294 TGCCCGGCCGCCACCCGGTCTGG + Intergenic
1114269115 14:21090683-21090705 TGCACCACAGCCGCCGGGCTAGG - Exonic
1114270670 14:21098316-21098338 CGCTCCGCCGCCGCCCGCCCGGG - Exonic
1114491999 14:23108413-23108435 TGCCCGGCCGCCGCCCCGTCTGG - Intergenic
1114507916 14:23232480-23232502 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1114524610 14:23359928-23359950 TGCCCCGCAGCCCCCTGGAGAGG - Exonic
1114558957 14:23577687-23577709 TGCCCCAGAGCCACCGGGCCAGG - Intronic
1114578702 14:23736853-23736875 CGCCCGGCAGCCGCCCTGTCTGG + Intergenic
1115493938 14:33984482-33984504 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1115504280 14:34079034-34079056 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1115504291 14:34079082-34079104 TGCCCGGCAGCCACCCCGTCAGG + Intronic
1115547524 14:34476384-34476406 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1115622333 14:35152669-35152691 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1115906677 14:38209436-38209458 TTCGCCGCAGCTGCCCGGGCTGG - Exonic
1116959640 14:50956545-50956567 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1117010631 14:51467566-51467588 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1117251862 14:53946869-53946891 GCCCCCGCCGCCGCCGGGCCTGG + Intergenic
1117276949 14:54203183-54203205 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1117596850 14:57333731-57333753 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1117596860 14:57333771-57333793 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1117763676 14:59058942-59058964 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1118209218 14:63751020-63751042 TGCCCGGCCGCCGCCCCGTCCGG - Intergenic
1118238967 14:64037960-64037982 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1118253235 14:64183034-64183056 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
1118253246 14:64183074-64183096 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1118584608 14:67341082-67341104 TGCCCAGCCGCCACCCGGTCTGG + Intronic
1118584687 14:67341391-67341413 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1118955573 14:70477649-70477671 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
1118955687 14:70477914-70477936 TGCCCGGCCGCCGCCCTGTCCGG + Intergenic
1119254581 14:73184804-73184826 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1119254595 14:73184844-73184866 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1119722032 14:76898147-76898169 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1119781597 14:77279775-77279797 TGCCCTGCTGCCGCCAGGTCAGG + Intronic
1120170564 14:81244569-81244591 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1120406584 14:84099614-84099636 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1120406594 14:84099654-84099676 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1120505802 14:85352769-85352791 TGCCCGGCAGCCACCCTGTCTGG - Intergenic
1120547584 14:85829851-85829873 TGCCCAGCAGCCACCCTGTCTGG - Intergenic
1121832320 14:97063101-97063123 TGCCCCTCAGCAACCCGGCAAGG + Intergenic
1122272490 14:100574421-100574443 TGCCCCGGTGCCGCCAGGCTAGG + Intronic
1122497945 14:102172729-102172751 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1122558404 14:102593338-102593360 ATCCCCGCCGCCGGCCGGCCGGG - Intronic
1122657924 14:103274198-103274220 AGCCCCGCAGCAGCCCCGGCAGG + Intergenic
1122742453 14:103880139-103880161 TGCCCCACCCCCACCCGGCCGGG + Intergenic
1122775940 14:104117006-104117028 GGCCCGGGAGCCGCCCCGCCCGG + Intergenic
1122775964 14:104117070-104117092 TGCGGCGCAGCCGCCCTTCCCGG - Intergenic
1122871762 14:104642023-104642045 AGCCCCGCATTCGCGCGGCCTGG + Intergenic
1122957752 14:105079249-105079271 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1123030611 14:105449516-105449538 TGCCCTGCGCCCGGCCGGCCCGG + Intronic
1123036700 14:105474656-105474678 TGCCCCGCACCCGCCACCCCCGG + Intronic
1123040426 14:105488036-105488058 TAGCCCGCATCCGCCCAGCCTGG - Intronic
1123429606 15:20203809-20203831 TGCCCAGCTGCCGCCCTGTCTGG - Intergenic
1123709982 15:22980194-22980216 GGCCCCGCCGCCGCCCTGGCCGG + Intronic
1124426978 15:29570745-29570767 TCGCCCGCTCCCGCCCGGCCCGG + Intergenic
1124453848 15:29822500-29822522 AGCCCCGCCCCCGCCGGGCCGGG - Exonic
1124607864 15:31184646-31184668 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1124607887 15:31184723-31184745 TGCCCGGCAGCCGCCCTGTCTGG + Intergenic
1124696903 15:31870853-31870875 TGCCCCGCCCCCGCCCCTCCGGG + Intergenic
1125459661 15:39894419-39894441 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1125566545 15:40682850-40682872 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1126210700 15:46098037-46098059 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1126210725 15:46098114-46098136 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
1126295379 15:47132587-47132609 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1126571576 15:50158319-50158341 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1126691891 15:51294550-51294572 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1126799427 15:52286190-52286212 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1126816444 15:52459691-52459713 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1126816475 15:52459768-52459790 TGCCCGGCCGCCGCCCCGTCTGG - Intronic
1126816543 15:52459962-52459984 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1127192040 15:56540778-56540800 TGCCCAGCCGCCACCCTGCCTGG + Intergenic
1127293663 15:57591855-57591877 GGCCCCGCCCCGGCCCGGCCCGG + Intergenic
1127874302 15:63099032-63099054 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1128071332 15:64799163-64799185 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1128374586 15:67065988-67066010 TGCAGCGCCGCGGCCCGGCCCGG + Exonic
1128587181 15:68860332-68860354 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1128743121 15:70096844-70096866 TCCCCCGCACCTCCCCGGCCCGG - Exonic
1128843712 15:70871634-70871656 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1129252509 15:74316587-74316609 TGCCCCTCAGCCTCCCCACCAGG - Intronic
1129428543 15:75481624-75481646 CGCCCGCCAGCCGCCCGTCCGGG + Intronic
1129431234 15:75503473-75503495 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1129431245 15:75503513-75503535 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1130071106 15:80647557-80647579 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1130946264 15:88552601-88552623 TGCCCGCCAGCCGCCCCGTCCGG - Intergenic
1131127073 15:89867420-89867442 TGCCCGGCCGCCACCCGGTCTGG + Intronic
1131228545 15:90644452-90644474 TGCACAGCAGCCACCCTGCCTGG + Intronic
1131260460 15:90884868-90884890 TACCCAGCAGCAGCCTGGCCTGG - Intronic
1131479304 15:92768248-92768270 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1131510116 15:93045068-93045090 AGCCCCGCAGCCGCCCTGCCTGG + Exonic
1132036978 15:98493045-98493067 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1132289039 15:100686473-100686495 TGTCCAGCAGCAGCCCTGCCGGG - Intergenic
1132406345 15:101543648-101543670 GGCTCCGCAGCCGGCCTGCCTGG - Intergenic
1132499893 16:280611-280633 CGCCCCGCCGCCGCCCCGCTCGG - Exonic
1132572921 16:651814-651836 TGTCCCCCAGCAGTCCGGCCGGG + Exonic
1132591141 16:726986-727008 GCCCCCGCCCCCGCCCGGCCCGG - Intronic
1132640212 16:974755-974777 TGTCCCCCAGCACCCCGGCCTGG + Intronic
1132668912 16:1094821-1094843 TGCACTGCTGCCGCCCGGCCTGG - Exonic
1132671392 16:1103505-1103527 TGACCTGCAGCCTCCCAGCCTGG - Intergenic
1132741413 16:1414923-1414945 TGCCCTGCAGCCCCCGGCCCGGG + Intergenic
1132807600 16:1782301-1782323 TCCCCGGCGGCAGCCCGGCCTGG + Intronic
1133239295 16:4404975-4404997 TGCCCCGCACCTGCCTGTCCTGG + Intronic
1133784571 16:8964055-8964077 TGCCCCGCAGCGCCGCGCCCCGG + Intronic
1134626610 16:15726979-15727001 GGACCCGCAGCTCCCCGGCCAGG + Exonic
1135575663 16:23583690-23583712 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1135575674 16:23583730-23583752 CGCCCGGCAGCCGCCCCGTCAGG + Intronic
1135694313 16:24574171-24574193 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1137029304 16:35506955-35506977 CGCCCCGCATCCCCCCGCCCTGG - Intergenic
1137240817 16:46653439-46653461 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1137283868 16:47000254-47000276 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1137283878 16:47000294-47000316 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1138028259 16:53539494-53539516 TGCCCAGCAGCCACCCCGTCCGG + Intergenic
1138681232 16:58684775-58684797 TGTCCCGCGGCCGCCCGAGCGGG - Intronic
1139364861 16:66427115-66427137 TGCCCTGCCGCAGCCCCGCCCGG - Intergenic
1139394773 16:66631135-66631157 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1139623216 16:68163600-68163622 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1139639216 16:68278911-68278933 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1139885457 16:70204739-70204761 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1140063285 16:71589556-71589578 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1140512213 16:75516843-75516865 GGCCTCGGAGCGGCCCGGCCCGG - Intergenic
1140602927 16:76500081-76500103 TGCCCCGCCGCCACCCCGTCAGG - Intronic
1140994093 16:80243332-80243354 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1141728735 16:85808213-85808235 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1142004919 16:87685126-87685148 AGCCCCGCAGCCCCCAGGCTGGG - Intronic
1142066223 16:88064577-88064599 TGCCACACAGGCGCCCAGCCTGG - Intronic
1142188625 16:88706654-88706676 TGCCCCGAAGGGTCCCGGCCGGG + Intronic
1142265144 16:89061027-89061049 TGCCCAGCAGCAGCCCAGCTGGG + Intergenic
1142533626 17:598798-598820 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1142667509 17:1471189-1471211 TTCCCCGCAGGCACCCGGCACGG + Intronic
1142875483 17:2849653-2849675 TGCCCGGCAGCTGCCAGCCCAGG - Intronic
1142939881 17:3371982-3372004 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1143008842 17:3854447-3854469 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1143008893 17:3854573-3854595 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1143667712 17:8373929-8373951 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1144338978 17:14297501-14297523 TGTCCCGCAGCTGCGAGGCCGGG + Intergenic
1144536381 17:16095362-16095384 CGCCCGGCAGCCACCCCGCCCGG + Intronic
1144541316 17:16145539-16145561 TGCCCCGCCGCCACCCTGTCTGG + Intronic
1144541336 17:16145616-16145638 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1144559786 17:16312158-16312180 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
1144787658 17:17840770-17840792 TGCCCCCCTGCCCCCCTGCCTGG + Intergenic
1144854112 17:18258600-18258622 GGCCCGGCACGCGCCCGGCCCGG + Intronic
1144866380 17:18338329-18338351 TGCCCGGCAGCTGCCCTGTCCGG + Intronic
1145087064 17:19951106-19951128 AGCCCGGCAGCCGCCCCGTCCGG + Intronic
1145418144 17:22741387-22741409 CGCCCGGCAGCCACCCCGCCCGG + Intergenic
1145684233 17:26638298-26638320 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1145684244 17:26638338-26638360 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1145828167 17:27893070-27893092 TCCTCCGAGGCCGCCCGGCCAGG + Intronic
1145936325 17:28717042-28717064 TGTCCCGCAGCCAAGCGGCCCGG + Intronic
1146322633 17:31858911-31858933 AGCCCCGCGGCCCCGCGGCCTGG + Intronic
1146731389 17:35195601-35195623 TGCCCAGCCGCCACCCCGCCTGG - Intergenic
1147024169 17:37565881-37565903 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1147150329 17:38510449-38510471 TGGCGCGCCGCCGCCTGGCCCGG + Exonic
1147150355 17:38510513-38510535 CGCCCCGGAGCCGCCCGGCTCGG + Exonic
1147277872 17:39333825-39333847 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1147719807 17:42532127-42532149 GGCGCCGCCGCCGCCGGGCCGGG + Intergenic
1147897450 17:43759877-43759899 TGCCCCCCCGCCCCCCGCCCCGG - Intergenic
1148157491 17:45432223-45432245 TTTCCCGGAGCAGCCCGGCCGGG + Intronic
1148299537 17:46534843-46534865 TGCCCGGCAGCCGCCCTGTCTGG - Intronic
1148388610 17:47254105-47254127 AGCCCCGCCACCGCCGGGCCAGG - Intronic
1150061581 17:62073090-62073112 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1150212046 17:63446792-63446814 TGCCCCGCCCTCGCCCTGCCCGG + Intergenic
1150250274 17:63700770-63700792 CTCCCCGCAGCCTCGCGGCCGGG - Intronic
1150380624 17:64716744-64716766 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1150518277 17:65837483-65837505 TGCCCCGCTGCCACCCCGTCTGG + Intronic
1150518298 17:65837560-65837582 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
1150653499 17:67024838-67024860 TGCCCCCCACCTCCCCGGCCAGG + Exonic
1150675740 17:67245026-67245048 TGCCCCGGGGCCGCCGCGCCCGG + Intronic
1150780280 17:68116258-68116280 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1150780291 17:68116298-68116320 CGCCCGGCAGCCGCCCAGTCTGG - Intergenic
1150780303 17:68116338-68116360 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1150894577 17:69196122-69196144 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1150894629 17:69196249-69196271 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1151917592 17:77129876-77129898 TGACCCGCAGCTGCACAGCCAGG + Intronic
1152394540 17:80024182-80024204 TGCCCCGCTGCAGTCCTGCCTGG - Intronic
1152478973 17:80537496-80537518 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1152499430 17:80698062-80698084 TGCCCCGCACCCACCCGTCTGGG - Intronic
1152545894 17:80999961-80999983 TGCCCCACAGCCTCCAGTCCTGG - Exonic
1152593992 17:81229388-81229410 GGCCCCACAGCCGCCCTCCCAGG - Exonic
1152596226 17:81239055-81239077 TGCCCCGCTTCCGCCAGGCCCGG + Exonic
1152635849 17:81430221-81430243 CGCCCCCCAGCTGCCTGGCCAGG + Intronic
1152672689 17:81618414-81618436 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
1152696206 17:81798021-81798043 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1152706683 17:81847213-81847235 TGCCCTGCAGCCCCCAGGCTGGG - Intronic
1152759529 17:82100706-82100728 TCCCCCGCACCCCCCAGGCCTGG - Intergenic
1152924172 17:83079920-83079942 CGCCGCCCAGCAGCCCGGCCAGG - Exonic
1153646879 18:7203746-7203768 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1154089623 18:11344794-11344816 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1154158198 18:11959965-11959987 CGCCCGGCAGCCACCCCGCCCGG + Intergenic
1154173398 18:12067103-12067125 GGCCCCCCGGCCGCCCCGCCGGG + Intergenic
1154289947 18:13098378-13098400 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1155956471 18:31960367-31960389 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1155956481 18:31960407-31960429 TGCCCGGCAGCTGCCCCGTCCGG + Intergenic
1156066370 18:33147889-33147911 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1156066399 18:33147965-33147987 TGCCCGGCCGCCGCCCCGTCCGG - Intronic
1156502065 18:37566293-37566315 CTCCCCGCGGCCGCCGGGCCCGG - Intergenic
1157385201 18:47254453-47254475 TGAACCGCAGCCGCCCGGAACGG - Intergenic
1157455895 18:47828197-47828219 CGCCCAGCAGCCGCCCCGTCTGG + Exonic
1157629467 18:49080660-49080682 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1157629477 18:49080700-49080722 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1157799700 18:50609319-50609341 CGCCCGGCCGCCGCCCCGCCCGG - Intronic
1157857723 18:51117280-51117302 TGCCCAGCAGCTGCCCTGTCCGG - Intergenic
1157857732 18:51117320-51117342 CGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1158601942 18:58863511-58863533 GCCGCCGCCGCCGCCCGGCCCGG + Intronic
1158643117 18:59220099-59220121 AGCCCCCCAGCCCCCCCGCCCGG + Intergenic
1158646882 18:59255659-59255681 TGCCCCGCTGCCACCCCGTCTGG + Intergenic
1158646917 18:59255775-59255797 CGCCCAGCAGCCGCCCGGTGGGG + Intergenic
1158658154 18:59359383-59359405 TTCCGCGCGGCCGCACGGCCAGG + Exonic
1158718362 18:59900264-59900286 GGCCCCGACCCCGCCCGGCCTGG - Intronic
1159158058 18:64609075-64609097 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1159158068 18:64609115-64609137 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1159614897 18:70569704-70569726 TGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1160465426 18:79072714-79072736 CGCCCAGCAGCCGCCTGGTCTGG - Intronic
1160738676 19:676246-676268 CCCCCCGCAGCGGCCGGGCCCGG + Intergenic
1160833077 19:1112326-1112348 GGCCCCGCCCCCGCCTGGCCGGG - Intronic
1160865750 19:1255226-1255248 TGACCCGCGGCCCCCCGGGCAGG - Intronic
1161087876 19:2343480-2343502 CGCCCCGCAGCCACCCACCCAGG - Intronic
1161112732 19:2479103-2479125 TGCCCTGCAGCCCCCAAGCCTGG + Intergenic
1161215859 19:3094801-3094823 GGGCCCGCAGCCGGCAGGCCCGG - Intronic
1161628593 19:5340234-5340256 GGCCCCGGCGGCGCCCGGCCCGG - Intronic
1161790193 19:6355504-6355526 TGCCCAGCAGCCACCCCGTCTGG + Intergenic
1162106212 19:8371299-8371321 AGTCCCGCAGCTGCACGGCCAGG - Exonic
1162328086 19:10010416-10010438 CGCCCCGCAGCCGCCCCGACTGG - Exonic
1162683240 19:12362477-12362499 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
1162887134 19:13703997-13704019 TGCCCGGCCACCGCCCGGTCTGG + Intergenic
1163400116 19:17087076-17087098 TGCCCAGCATCAGCCTGGCCCGG + Intronic
1163607274 19:18281990-18282012 GCCCCCGCCCCCGCCCGGCCGGG - Intergenic
1163635095 19:18433881-18433903 GGCCCCCCGGCCGCCCCGCCGGG - Intronic
1163678610 19:18668108-18668130 TGGCGCGCGGCCGCCGGGCCGGG - Exonic
1163904294 19:20137916-20137938 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1163986110 19:20952701-20952723 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1164016727 19:21260788-21260810 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1164034767 19:21443634-21443656 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1164034779 19:21443674-21443696 CGCCCGGCAGCCGCCCCGCCTGG - Intronic
1164054096 19:21607252-21607274 CGCCTGGCAGCCGCCCGGTCTGG - Intergenic
1164065000 19:21707953-21707975 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1164168120 19:22700527-22700549 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1164168529 19:22703052-22703074 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164168540 19:22703092-22703114 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164186184 19:22871597-22871619 CGCCCGGCAGCCACCCCGCCTGG - Intergenic
1164256629 19:23533532-23533554 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1164659303 19:29949147-29949169 TGCCCCACAGCCGCCCCATCTGG - Intronic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1164755670 19:30687131-30687153 AGCCCCGCGTCTGCCCGGCCGGG - Intronic
1166105766 19:40597359-40597381 GGGTCCCCAGCCGCCCGGCCAGG + Exonic
1166115060 19:40648407-40648429 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1166191611 19:41180309-41180331 TGCCCGGCAGCCACCCAGTCTGG + Intergenic
1166191622 19:41180349-41180371 CGCCCGGCAGCCGCCCCGGCCGG + Intergenic
1166218843 19:41352956-41352978 AGTCCCGCGGCCGGCCGGCCAGG + Exonic
1166301320 19:41913485-41913507 TGACCCGCAGCCGCCCAGGACGG + Intronic
1166301331 19:41913499-41913521 TGCCCCCCTGCAGCCCGTCCTGG - Intronic
1166304236 19:41928549-41928571 GCCCTCGCGGCCGCCCGGCCGGG + Intronic
1166418045 19:42610549-42610571 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1166611674 19:44204009-44204031 TGCCCCGCTGCCACCCTGTCTGG + Intergenic
1166611707 19:44204126-44204148 CGCCCGGCAGCCGCCCTGTCTGG + Intergenic
1166852785 19:45768478-45768500 TGCCACGTAGGCGCTCGGCCGGG + Exonic
1166995115 19:46716412-46716434 TCCCCCGGGGCCCCCCGGCCGGG - Exonic
1167239364 19:48334026-48334048 TGCCCCCTGGCCGCCGGGCCAGG + Exonic
1167913178 19:52720582-52720604 TGCCCAGCAGCTGCCCCGTCTGG - Intronic
1167924520 19:52811729-52811751 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1168213489 19:54908616-54908638 TGCCCCCCAACCTCCCGGACGGG + Intronic
1168572605 19:57483296-57483318 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1168572616 19:57483336-57483358 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
925169521 2:1742726-1742748 TGCCCCCGAGTCGTCCGGCCTGG + Intronic
926101646 2:10122238-10122260 TGCCCGGCGGCGGCCCGGCTGGG + Intergenic
926311170 2:11677315-11677337 TGCCCCGCGGCTGGCCGGCAGGG + Intergenic
926322661 2:11759918-11759940 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
926683436 2:15680623-15680645 TGCCCGGCCGCCACCCGGTCTGG - Intergenic
927755641 2:25705842-25705864 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
927997342 2:27495216-27495238 CGCTCCGCCGCAGCCCGGCCGGG + Exonic
928888834 2:36180154-36180176 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
929066081 2:37977480-37977502 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
929151944 2:38756037-38756059 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
929174228 2:38960531-38960553 CGCCGCGCAGGCGCACGGCCCGG + Exonic
929238309 2:39628349-39628371 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
929515928 2:42605490-42605512 TGCCCGCCAGCCGCCCCGTCCGG - Intronic
929577767 2:43063213-43063235 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
929650803 2:43677948-43677970 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
930136209 2:47905970-47905992 TCCCTCGCGGCCGCCCCGCCCGG - Intergenic
930208809 2:48614631-48614653 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
930363603 2:50411667-50411689 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
930665583 2:54096071-54096093 CGCCCCGCAGCCACCCCGTCCGG - Intronic
930827100 2:55705716-55705738 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
930833936 2:55773860-55773882 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
931576403 2:63722486-63722508 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
931584246 2:63809099-63809121 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
931584270 2:63809179-63809201 CGCCCGGCAGCCGCCCCGCCCGG + Intronic
932252695 2:70258320-70258342 TGCGCAGCGGCCGCCCGGCGCGG - Intronic
932253805 2:70267027-70267049 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
932410270 2:71543099-71543121 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
932773255 2:74513361-74513383 GCCCCCGCCGCCGCCCTGCCCGG - Intergenic
932807523 2:74796188-74796210 TGCCCAGCAGCCACCCCGTCCGG - Intergenic
933868465 2:86545533-86545555 TGCCCGGCAGTCGCCCCGTCTGG - Intronic
933868475 2:86545573-86545595 TGCCCGGCAGTCGCCCCGTCTGG - Intronic
933907945 2:86913977-86913999 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933907958 2:86914011-86914033 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933907983 2:86914075-86914097 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908003 2:86914124-86914146 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908031 2:86914201-86914223 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908042 2:86914229-86914251 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908077 2:86914325-86914347 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908093 2:86914371-86914393 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908107 2:86914411-86914433 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908151 2:86914536-86914558 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908174 2:86914603-86914625 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908186 2:86914637-86914659 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908199 2:86914674-86914696 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908213 2:86914714-86914736 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908229 2:86914760-86914782 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908257 2:86914840-86914862 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933908275 2:86914892-86914914 GCCTCCGCCGCCGCCCGGCCAGG - Intronic
933908287 2:86914926-86914948 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911157 2:86942476-86942498 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911167 2:86942504-86942526 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911177 2:86942532-86942554 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
933911208 2:86942650-86942672 GCCGCCGCCGCCGCCCGGCCAGG - Intronic
934011420 2:87824715-87824737 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011435 2:87824755-87824777 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011451 2:87824798-87824820 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011463 2:87824829-87824851 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011551 2:87825383-87825405 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934011568 2:87825429-87825451 GCCGCCGCCGCCGCCCGGCCAGG + Intronic
934128342 2:88920597-88920619 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
934652099 2:96098621-96098643 TGCCCAGCAGCCGCCAGTCCTGG - Intergenic
934703354 2:96461200-96461222 TGCCCGGCCGCCACCCGGTCTGG + Intergenic
934765147 2:96876362-96876384 TGCCCTGCAGCTCCCCGGGCTGG + Intronic
934896849 2:98126969-98126991 CGCCCCCCACCCTCCCGGCCAGG + Intronic
934998544 2:98988965-98988987 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
936531379 2:113278830-113278852 GGGCCTGCAGCCGGCCGGCCAGG - Exonic
937437621 2:121892942-121892964 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
937734881 2:125277138-125277160 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
937947492 2:127353496-127353518 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
938055070 2:128208564-128208586 TGTCCTGCCGCCGCCCGGTCTGG + Intergenic
938289478 2:130141807-130141829 TGCCCAGCAGCAGCCCTGCTTGG - Intronic
938467051 2:131531131-131531153 TGCCCAGCAGCAGCCCTGCTTGG + Intronic
940817247 2:158310560-158310582 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
941025120 2:160449091-160449113 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
941603175 2:167564061-167564083 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
941768744 2:169327053-169327075 CGCCCGGCAGCCGCCCAGTCCGG + Intronic
941786629 2:169505755-169505777 TGCCCAGCAGCCACCCTGTCTGG + Exonic
941793352 2:169575444-169575466 CGCCCAGCAGCCGCCCCGTCAGG - Intergenic
941822348 2:169856030-169856052 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
941822361 2:169856070-169856092 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
941822385 2:169856148-169856170 TGCCCCGCCGCCACCCCGTCTGG - Intronic
941847807 2:170149995-170150017 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
942012243 2:171774918-171774940 TGCCCGGCCGCCGCCCCGTCCGG + Intergenic
942021029 2:171866871-171866893 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
942355633 2:175108250-175108272 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
942630137 2:177945616-177945638 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
943100379 2:183479394-183479416 CGCCCGGCAGCCGCCCTGTCCGG + Intergenic
943125768 2:183792326-183792348 TGCCCGGCAGCCGCCCTGTCTGG - Intergenic
943323448 2:186473046-186473068 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
943411626 2:187556308-187556330 TGCCCGGCCGCCACCCCGCCTGG + Intronic
943411728 2:187556697-187556719 TGCCCAGCAGCCACCCTGTCTGG + Intronic
943411736 2:187556737-187556759 TGCCCAGCAGCCACCCCGTCTGG + Intronic
943578133 2:189653873-189653895 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
943587734 2:189760395-189760417 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
943648305 2:190430863-190430885 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
943863184 2:192894172-192894194 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
943863214 2:192894257-192894279 CGCCCAGCAGCCGCCCGGTCCGG + Intergenic
944060841 2:195568295-195568317 TGCCCGCCAGCCGCCCGTCCGGG + Intergenic
944060863 2:195568342-195568364 CGCCCGCCAGCCGCCCGTCCGGG + Intergenic
944533056 2:200683953-200683975 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
944570799 2:201042520-201042542 TGCCCCGCCGCCACCCCGTCTGG + Intronic
944570820 2:201042597-201042619 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
944570846 2:201042671-201042693 CGCCCGGCAGCCGCCCAGTCCGG + Intronic
944801224 2:203239343-203239365 TACCCCTCAGGCGCCGGGCCAGG + Intronic
945110655 2:206356998-206357020 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
945864797 2:215163378-215163400 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
946313847 2:218897167-218897189 CGCACCGCAGCGGCCCGGCCTGG - Intronic
946340053 2:219060814-219060836 GGCCCTGCAGCCCGCCGGCCCGG - Intergenic
946447342 2:219751194-219751216 CGCCCTGCAGCCGCCCGTCCGGG - Intergenic
946447353 2:219751234-219751256 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
946865563 2:224038970-224038992 GGCCCCGCAGCTTCCCGGCCGGG + Intronic
947592931 2:231395584-231395606 CGCCCCGCCGCCGCCTGGCGGGG - Exonic
948147597 2:235719733-235719755 TGCCCTGCAGCAGCCCTCCCTGG + Intronic
948627433 2:239277655-239277677 GGCCACACAGCCGCCCAGCCTGG + Intronic
948645308 2:239400658-239400680 TGGCCCGCGGGCGCCGGGCCGGG + Exonic
948730409 2:239959907-239959929 TGCTCCGCAGCAGCGAGGCCTGG + Exonic
948809027 2:240465661-240465683 GGCCCCTTGGCCGCCCGGCCAGG - Intronic
948850031 2:240701329-240701351 GGCGCCGCAGCAGCACGGCCTGG - Intergenic
1169115583 20:3063308-3063330 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1169125775 20:3125674-3125696 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
1169449875 20:5702069-5702091 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1169718307 20:8644672-8644694 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1169991901 20:11513422-11513444 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1169991912 20:11513462-11513484 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1170202548 20:13760632-13760654 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1170592181 20:17779217-17779239 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1170623130 20:18010673-18010695 CGCCCGGCAGCCGCCCCGACCGG - Intronic
1170623141 20:18010713-18010735 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1170645701 20:18194590-18194612 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1170664583 20:18375726-18375748 TGCCCGGCAGCTGCCCCGTCCGG - Intergenic
1170780705 20:19423119-19423141 TGCCCCGCATCCAGCCGGTCTGG + Intronic
1170889890 20:20368160-20368182 AGTCCCGCAGCCGCCGCGCCCGG + Exonic
1171012733 20:21517321-21517343 TGCCCAGCTGCCCCCAGGCCAGG - Intergenic
1171499636 20:25583975-25583997 TGCCCCCCACCCGCCCCGACAGG - Intronic
1171848483 20:30291850-30291872 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1171899905 20:30847177-30847199 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1171951645 20:31427137-31427159 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1171957483 20:31471561-31471583 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1171957494 20:31471601-31471623 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1172118707 20:32585480-32585502 GGCCCAGCCCCCGCCCGGCCCGG + Intronic
1172237738 20:33389461-33389483 CGCCCAGCAGCCGCCCCGTCCGG + Intronic
1172279318 20:33699331-33699353 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1172379243 20:34474854-34474876 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1172599664 20:36175093-36175115 TGCCCCACCGCCGCCCGCCCCGG - Intronic
1172739055 20:37151160-37151182 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1172739074 20:37151200-37151222 CGCCCGGCAGCCGCCCTGTCCGG + Intronic
1172910739 20:38407441-38407463 TGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1172910769 20:38407558-38407580 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1172910779 20:38407598-38407620 CGCCCAGCAGCCGCCCTGTCCGG + Intergenic
1172910870 20:38407806-38407828 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1173273168 20:41555469-41555491 CGCCCGGCAGCCGCCCTGTCTGG - Intronic
1175385825 20:58594525-58594547 TGCCCCCCTGCCTCCCAGCCAGG + Intergenic
1175399668 20:58693136-58693158 ACCCCCGCCGCCGCCGGGCCGGG + Intronic
1175439633 20:58981530-58981552 CGCCCCGCCCCCGCCCGCCCGGG + Intronic
1175775905 20:61653583-61653605 TGCCCGGCAGCCACCCCGTCCGG - Intronic
1175847005 20:62064798-62064820 GGCGCCGCAGCCGCCGCGCCGGG + Exonic
1176233268 20:64042547-64042569 TTCCTCGCAGCCTCCCCGCCTGG + Intronic
1176286249 21:5020907-5020929 TTACCAGCAGCCGCCCGCCCCGG + Intergenic
1176656702 21:9593803-9593825 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1176656712 21:9593843-9593865 TGCCCGGCAGCCACCCTGTCTGG - Intergenic
1177788235 21:25695499-25695521 TGCCCCGCGGCCGCCCCGTCTGG - Intronic
1177788267 21:25695576-25695598 TGCCCGGCCGCCGCCCCGTCCGG - Intronic
1178873152 21:36392606-36392628 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1178873165 21:36392646-36392668 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1179329613 21:40386460-40386482 TCTCCCGCAGCGGCCCGGCGTGG - Intronic
1179870932 21:44242568-44242590 TTACCAGCAGCCGCCCGCCCCGG - Intergenic
1179929413 21:44557552-44557574 TCCCCCACACCCACCCGGCCCGG - Intronic
1179932352 21:44579099-44579121 GGCACCGCAGCCTCCAGGCCTGG - Intronic
1179969176 21:44824879-44824901 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1179999546 21:44989122-44989144 TGCCCTGCTGCTCCCCGGCCTGG + Intergenic
1180183968 21:46130421-46130443 TGCCCGGCAGGAGCCCAGCCTGG - Intronic
1180235861 21:46459069-46459091 TGCGCTGCCGCCGCCAGGCCCGG + Intronic
1180739301 22:18041704-18041726 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1180801827 22:18635525-18635547 TGCCCAGCACCCGCTCAGCCAGG + Intergenic
1180861326 22:19084597-19084619 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1181219893 22:21359736-21359758 TGCCCAGCACCCGCTCAGCCAGG - Intergenic
1181273971 22:21677048-21677070 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1181296967 22:21847713-21847735 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1181374088 22:22441914-22441936 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
1181598899 22:23937238-23937260 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1181776909 22:25166441-25166463 TGCCCCCCTGCCGCCTGCCCTGG + Intronic
1182399828 22:30066856-30066878 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1182564009 22:31184155-31184177 TGCCCGGCAGCCGCCCCGTCCGG - Intronic
1183220011 22:36506455-36506477 TGTCTCCCAGCCGCCGGGCCGGG - Intronic
1183386673 22:37519175-37519197 TCCCCCGCCTCCGCCCGGCCCGG + Exonic
1183434739 22:37786944-37786966 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1183472477 22:38016965-38016987 TGCCCCCCGGCACCCCGGCCTGG - Intronic
1183537227 22:38410089-38410111 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1183595238 22:38807172-38807194 CGCCCGGCAGCCACCCCGCCCGG + Intergenic
1184145500 22:42607865-42607887 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
1184145511 22:42607905-42607927 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1184169481 22:42750601-42750623 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1184201330 22:42971728-42971750 TGTCCGGCAGCCGCCCCGTCCGG + Intronic
1184459516 22:44629051-44629073 TGCCCGGCCGCCGCCCTGTCTGG + Intergenic
1184557438 22:45240929-45240951 CGCCCCGCCCCGGCCCGGCCCGG + Intergenic
1184640413 22:45867335-45867357 AGCACCTCCGCCGCCCGGCCTGG + Intergenic
1185271116 22:49929653-49929675 CCCCTCGGAGCCGCCCGGCCTGG + Intergenic
1185332442 22:50257814-50257836 TGCCCTGCAGCCGACCACCCTGG - Intronic
949551130 3:5113813-5113835 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
949712061 3:6882500-6882522 TGCACCACTGCCCCCCGGCCTGG + Intronic
949989891 3:9570126-9570148 TGCCCCGCAGCCGCCCCGTCCGG + Intergenic
950044287 3:9940022-9940044 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
950742400 3:15061973-15061995 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
950742411 3:15062013-15062035 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
950754884 3:15163259-15163281 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
950754895 3:15163299-15163321 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
951264142 3:20547850-20547872 TTCCTGGCAGCCGCCCGGTCTGG - Intergenic
951550523 3:23871571-23871593 TGCCCGGCAGCCACCCCGTCTGG - Intronic
952892620 3:38053507-38053529 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
952894016 3:38064654-38064676 TGCCCCGCAGCCACCCCGTCCGG - Intronic
953084874 3:39655960-39655982 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
953084909 3:39656040-39656062 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
953200765 3:40776808-40776830 TGCCCTGCAGAGGCCCAGCCTGG - Intergenic
953357301 3:42266016-42266038 TGCACCGAGGCCGCCCAGCCTGG + Exonic
953966203 3:47309292-47309314 TGCCCGGCCGCCGCCCCGTCTGG - Intronic
954048258 3:47951758-47951780 TGCCCGGCAGCCACCCCGTCTGG + Intronic
954060322 3:48061679-48061701 TGCCCGGCAGCCGCCCCGTCTGG + Intronic
954425393 3:50440315-50440337 TGGCACGCAGCCCCCCTGCCTGG - Intronic
954481339 3:50803938-50803960 TGCCCGGCAGCCGCCCCATCTGG - Intronic
954566922 3:51607706-51607728 TGCCCGGCCGCCGCCCCGTCTGG - Intronic
954567047 3:51607985-51608007 CGCCCCGCAGCTGCCCCGCCCGG - Intronic
954567057 3:51608025-51608047 TGCCCGGCAGCCGCCCTGTCCGG - Intronic
955172994 3:56584170-56584192 CGCCCGGCAGCCGCCCCGCCCGG - Intronic
955173133 3:56584679-56584701 TGCCCGGCCGCCACCCTGCCTGG - Intronic
955626857 3:60927740-60927762 CACCCGGCAGCCGCCCCGCCTGG + Intronic
955651765 3:61202322-61202344 TGCTCGGCAGCCGCCCTGTCTGG + Intronic
955670073 3:61393626-61393648 CGCCCAGCAGCCGCCCCGTCTGG - Intergenic
955674431 3:61434619-61434641 TGCCCGCCAGCCGCCCCGTCCGG - Intergenic
956803842 3:72788431-72788453 TGCCCGGCAGCCGCCCTGTCAGG + Intronic
957620124 3:82584624-82584646 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
957646750 3:82939905-82939927 AGCCCAGGAGCCGCCCGCCCAGG + Intergenic
958692045 3:97481063-97481085 TGCCCCGCTGCCACCCCGTCTGG - Intronic
959201682 3:103255019-103255041 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
959419042 3:106111132-106111154 TGCCCGCCAGCCGCCCGTCCGGG - Intergenic
959419193 3:106111453-106111475 TGCCCGCCAGCCGCCCCGTCCGG - Intergenic
959539868 3:107525236-107525258 GGCACCGCCGGCGCCCGGCCCGG - Intronic
959683786 3:109124210-109124232 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
960030110 3:113046741-113046763 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
960344893 3:116519353-116519375 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
960577479 3:119242644-119242666 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
960577574 3:119242885-119242907 TGCCCAGCCGCCGCCCCGTCTGG + Intergenic
960577592 3:119242924-119242946 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
960625026 3:119674088-119674110 TGCCCAGCTGCCGCCCTGTCTGG + Intronic
960770801 3:121190855-121190877 TGCCCCGCCGCCACCCCGTCTGG - Intronic
960817463 3:121688594-121688616 TGCCCCGCCGCCACCCCGTCTGG + Intronic
960948487 3:122983047-122983069 CATCCCGCAGCCGCCCTGCCTGG - Intronic
960997328 3:123348772-123348794 TGCCCAGCTGCCTCCCTGCCAGG + Intronic
961120762 3:124368260-124368282 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
961163992 3:124750935-124750957 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
961498077 3:127308970-127308992 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
961674300 3:128555493-128555515 CGGCCCGCGGCCGCCCCGCCAGG + Intergenic
961704437 3:128773393-128773415 TGCCCGGCAGCCACCCCGTCCGG + Intronic
961784489 3:129339957-129339979 CGCCCAGCAGCCACCCGTCCGGG - Intergenic
962006238 3:131352632-131352654 TGACCCCCAGCCTCCCAGCCAGG - Intergenic
962520761 3:136195887-136195909 GGCGCCGCCGCGGCCCGGCCGGG - Intronic
962623077 3:137198558-137198580 TGCCCAGCAGCCACCCCGTCCGG - Intergenic
962623086 3:137198598-137198620 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
962688815 3:137872832-137872854 TGCCTGGCAGCCGCCCCGTCCGG + Intergenic
962787923 3:138785031-138785053 CGCCCCGCAGCCGCCCCGTCTGG + Intronic
962787932 3:138785071-138785093 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
963249072 3:143086746-143086768 CGCCCCGCAGCCACCCCGTCCGG - Intergenic
963776412 3:149445096-149445118 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
964765959 3:160178830-160178852 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
966351002 3:179032759-179032781 TGCCCCGCAGCCGCCCCGTCTGG + Intronic
966362802 3:179148454-179148476 CGCTCCGGAGCTGCCCGGCCGGG - Intronic
966375378 3:179290946-179290968 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
966617222 3:181925987-181926009 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
967127264 3:186435516-186435538 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
967178710 3:186884948-186884970 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
967849500 3:194071214-194071236 TGCCCCGCGCCCGCCCGGGCGGG - Intergenic
968042426 3:195599743-195599765 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
968042437 3:195599783-195599805 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
968156536 3:196385683-196385705 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
968230445 3:197002459-197002481 GGCCCCGCACCCGCTGGGCCTGG - Exonic
968471961 4:786515-786537 TGTCCTGCAGCGGCCCGGGCAGG + Exonic
968507169 4:976180-976202 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
968514250 4:1009775-1009797 GGCCCCGCCCCCGCCCGGCCAGG + Intergenic
968550655 4:1222130-1222152 TGCCCAGCACCGGCCCCGCCTGG + Intronic
968653846 4:1770355-1770377 GGCCCCGCGGCAGCCCGGGCGGG + Intergenic
968831683 4:2935336-2935358 TCCCCCTCAGCCGCCTGTCCTGG - Intergenic
968850585 4:3075038-3075060 GCCCCCGCCGCCACCCGGCCCGG + Exonic
968852814 4:3094765-3094787 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
969376636 4:6767758-6767780 TGTCCCCCTGCCGCCCGCCCGGG + Intergenic
969384763 4:6837189-6837211 CGCCCGGCAGCCGCCCCGCCTGG - Intronic
969508274 4:7602192-7602214 TGCCCGGCAGCCACCCCGTCTGG - Intronic
969508337 4:7602354-7602376 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
972270741 4:37509278-37509300 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
972938424 4:44167907-44167929 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
973021222 4:45207697-45207719 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
973263369 4:48186612-48186634 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
973274298 4:48292179-48292201 TGCCCGGCCGCCACCCGGTCTGG + Intergenic
973274395 4:48292560-48292582 TGCCCAGCAGCTGCCCCGTCTGG + Intergenic
973664075 4:53139443-53139465 TGCCCCGCCGCCACCCCGTCTGG + Intronic
973664097 4:53139520-53139542 TGCCCGGCAGCTGCCCCGTCTGG + Intronic
973664110 4:53139560-53139582 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
974076603 4:57173335-57173357 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
974385705 4:61200836-61200858 ATGCCCGCAGCTGCCCGGCCCGG + Intergenic
974597888 4:64037434-64037456 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
974870560 4:67637149-67637171 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
975633082 4:76421264-76421286 TGCTCGGCAGCTGCCCGGCGGGG + Intronic
975795948 4:78007242-78007264 CGCCCCGCAGCCGCCCTGTCTGG - Intergenic
975848381 4:78548136-78548158 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
976265090 4:83182314-83182336 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
976265101 4:83182354-83182376 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
976976220 4:91168467-91168489 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
976978678 4:91196141-91196163 TGCTCCACAGCAGTCCGGCCTGG + Intronic
978014316 4:103723504-103723526 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
978224889 4:106321426-106321448 TGCCCCGCCGCCACCCCGTCTGG + Exonic
978224912 4:106321503-106321525 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
978376147 4:108077359-108077381 TGCCCGGCTGCCGCCCTGTCTGG + Intronic
978376160 4:108077399-108077421 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978376173 4:108077439-108077461 TGCCCGGCTGCCGCCCAGTCTGG + Intronic
978376185 4:108077479-108077501 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978376198 4:108077519-108077541 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978376211 4:108077559-108077581 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978376224 4:108077599-108077621 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978376237 4:108077639-108077661 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
978947536 4:114516699-114516721 CGCCCCGCAGCCACCCTGTCCGG + Intergenic
979273699 4:118792166-118792188 TGCCCCGCCGCCACCCCGTCTGG + Intronic
979273724 4:118792243-118792265 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
979349332 4:119627506-119627528 TGCCCCGCTGCCGCCTGCTCTGG - Intronic
979622414 4:122812109-122812131 TGCCCGGCAGCCGACCCGTCCGG + Intergenic
979941782 4:126771360-126771382 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
979941792 4:126771400-126771422 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
980056398 4:128083545-128083567 TGCCCGCCAGCCGCCCCGTCCGG - Intronic
980056518 4:128083820-128083842 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
980056529 4:128083860-128083882 TGCCCGGCAGCCACCCCGTCTGG - Intronic
980883674 4:138739440-138739462 TGCCTGGCAGCCGCCCCGTCTGG + Intergenic
980883684 4:138739480-138739502 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
981315625 4:143337147-143337169 CGCCCCTCAGCTGCCCGGCCCGG + Exonic
981993695 4:150954119-150954141 TGCCCGGCAGCCGCCCCGTCGGG + Intronic
982053621 4:151526722-151526744 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
982274066 4:153622049-153622071 TGCCCCCCAGCCCCCCAGTCTGG + Intronic
982712189 4:158768888-158768910 GGCCCGGCGGCCGCCCGCCCCGG - Intergenic
983613712 4:169679012-169679034 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
983664410 4:170166234-170166256 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
983664462 4:170166362-170166384 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
983906028 4:173183837-173183859 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
983931673 4:173460051-173460073 TGCCCCGCCACCGCCCTGCAAGG + Intergenic
984260816 4:177442212-177442234 CGCGGCGCAGCCGCCCGCCCAGG + Intronic
984728108 4:183040768-183040790 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
984977188 4:185240670-185240692 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
985048753 4:185969437-185969459 TGCCCTGCAGCTGCCAGCCCAGG + Intergenic
985070450 4:186162506-186162528 TTCCCTGCAGCCTCCCTGCCAGG + Intronic
985216361 4:187658133-187658155 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
985267421 4:188162985-188163007 TGCCCAGCAGCAGCTCAGCCTGG - Intergenic
985537957 5:475074-475096 TGGACCGCAGCCTCCTGGCCAGG - Exonic
985538470 5:477057-477079 TGGCCCGCAGCAGCCTGTCCTGG - Intronic
986720193 5:10555542-10555564 GGCCCCGCAGCAGACCTGCCAGG - Intergenic
986721641 5:10564487-10564509 CGCCCCGCCGCCCTCCGGCCCGG - Exonic
987267998 5:16277055-16277077 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
988532881 5:32041038-32041060 TGCCCAGCAGCCGCCCCGTCTGG + Intronic
989211570 5:38862438-38862460 AGCCCAGCAGCCACCCGTCCGGG - Intronic
989372280 5:40722663-40722685 CGCCCCACAGCCGCCCAGTCTGG + Intronic
989372302 5:40722717-40722739 TGCCCCGCCACCTCCCGGACGGG - Intronic
989574749 5:42979452-42979474 CGCCCAGCAGCCGCCCTGTCTGG + Intergenic
989574761 5:42979492-42979514 CGCCCGGCAGCCGCCCTGTCCGG + Intergenic
989574771 5:42979531-42979553 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
989633511 5:43511318-43511340 TGCCCGGCAGCCGCCCCGTCCGG + Intronic
989648789 5:43665908-43665930 TGCCCCGCCGCCACCCCGTCCGG - Intronic
989655912 5:43746213-43746235 TGCCCGGCAGCTGCCCCGTCTGG - Intergenic
989663471 5:43824604-43824626 TGCCCAGCAGCCGCCCCATCTGG - Intergenic
989812593 5:45695950-45695972 GGCCCCGCCGCCCCCCGGCGGGG + Exonic
990293909 5:54381539-54381561 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
990459084 5:56015131-56015153 TGCCCGGCAGCCGCCCCGTCCGG - Intergenic
990485761 5:56258208-56258230 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
990501077 5:56397854-56397876 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
991375067 5:65957815-65957837 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
991935197 5:71794002-71794024 TGCCCGGCCGCCGCCCTGTCTGG - Intergenic
991935240 5:71794123-71794145 TGCCCGGCCGCCGCCCCGTCTGG - Intergenic
992289642 5:75270417-75270439 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
992415805 5:76551084-76551106 CGCCCCGCAGCCGCCCCGTCTGG - Intronic
992540722 5:77761026-77761048 TGCCCGGCTGCCGCCCCGTCTGG + Intronic
992574457 5:78096768-78096790 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
992574468 5:78096808-78096830 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
992801773 5:80301408-80301430 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
993723335 5:91343002-91343024 TGCCCGGCCGCCGCCCCGTCTGG - Intergenic
993723352 5:91343042-91343064 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
993934599 5:93985831-93985853 TGCCCCGCCGCCACCCCGTCTGG + Intronic
994320796 5:98392433-98392455 TGCCCCGCAGCCGGCCCAGCAGG - Intergenic
994907471 5:105859519-105859541 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
995047881 5:107670998-107671020 CGCGCTGCAGCCGCCCGGCCCGG - Intergenic
995236221 5:109832869-109832891 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
995515988 5:112955047-112955069 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
996159885 5:120148138-120148160 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
996716214 5:126590028-126590050 TGCCCAGCTGCCGCCCCGTCTGG + Intronic
997433529 5:133857962-133857984 TGCCCAGCAGCTGCCCTGTCTGG - Intergenic
997605666 5:135174151-135174173 TGACCCGCAGCCTCCGGGCCAGG + Exonic
997635097 5:135398976-135398998 TGCCCGGGAGCGGCCCGGCCTGG - Intronic
998060065 5:139112562-139112584 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
998166792 5:139848729-139848751 TCCCCCGCGCCGGCCCGGCCTGG - Intronic
998193011 5:140042833-140042855 AGCCCCGCAGCCCCGCAGCCCGG - Exonic
999455635 5:151714044-151714066 CGCCCCGCAGCCGCCCCGTCCGG - Intergenic
999455742 5:151714433-151714455 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
999532629 5:152479968-152479990 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
999532639 5:152480008-152480030 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
999979070 5:156940710-156940732 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
999979098 5:156940787-156940809 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1000032956 5:157419746-157419768 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
1000042906 5:157498350-157498372 TGCCCCACAGCCAGCCTGCCTGG + Intronic
1000318860 5:160118595-160118617 TGCCCCGCAGGCGCCCACCTGGG + Intronic
1000630246 5:163583824-163583846 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1001773431 5:174312065-174312087 CACCCCGCAGCTGCCCGTCCGGG - Intergenic
1001960914 5:175880009-175880031 TGTCCTGCAGCGGCCCGGGCAGG - Exonic
1002043227 5:176529005-176529027 GGCCACGCAGCCGCCTGCCCGGG - Exonic
1002401672 5:178994653-178994675 TGTCCAGCAGCCGCGCGCCCAGG + Exonic
1002626167 5:180531223-180531245 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003407436 6:5835889-5835911 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1003603993 6:7542713-7542735 GGCCCGGCAGCCGCCCCGGCGGG - Intronic
1004043972 6:12009214-12009236 TCCCACGCGGCCGCCCGGCCGGG - Intronic
1004152489 6:13134092-13134114 CGCCCGGCAGCCGCCCTGTCTGG + Intronic
1005414466 6:25586153-25586175 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1005624903 6:27653699-27653721 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1005682281 6:28218794-28218816 TCCCCCGGAGCCGCCCGGCCGGG + Intergenic
1005710857 6:28502234-28502256 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1005710883 6:28502311-28502333 CGCCCAGCAGCCGCCTGGTCTGG + Intergenic
1005710897 6:28502351-28502373 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1005710908 6:28502391-28502413 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1005710955 6:28502510-28502532 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1005929821 6:30475240-30475262 TGCCTGGCAGCCGCCCCGTCTGG + Intergenic
1005933190 6:30498837-30498859 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1006014106 6:31067126-31067148 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1006014156 6:31067250-31067272 CGCCCGGCAGCCGCCCCGTCAGG - Intergenic
1006014167 6:31067290-31067312 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1006064781 6:31454958-31454980 TGCCCGGCAGCCGCCCCATCCGG - Intergenic
1006065080 6:31455661-31455683 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1006065091 6:31455701-31455723 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1006092594 6:31636840-31636862 TGCTCTGCAGCCCCCCAGCCTGG + Exonic
1006122853 6:31817606-31817628 AGCCCCGAAGCCCCCAGGCCCGG - Exonic
1006124714 6:31829800-31829822 AGCCCCGAAGCCGCCAGGCCCGG - Exonic
1006225340 6:32532223-32532245 TGCCCCGCTGCCACCCCGTCTGG + Intergenic
1006225378 6:32532341-32532363 CGCCCTGCAGCCGCCCCGTCTGG + Intergenic
1006225389 6:32532381-32532403 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1006346302 6:33485756-33485778 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1006369231 6:33633847-33633869 GGCCCCGCCCCGGCCCGGCCCGG - Intronic
1006479770 6:34282656-34282678 TGCCCCCAAGCCTCCCAGCCAGG - Exonic
1006826843 6:36941741-36941763 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1007089518 6:39173457-39173479 TGCACCGTAGCTGCCTGGCCTGG + Intergenic
1007544992 6:42686762-42686784 CGCCCAGCAGCCGCCCAGTCCGG - Intronic
1007545002 6:42686802-42686824 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1008106351 6:47444089-47444111 TGCCGGGCAGCCGCCCCGTCCGG - Intergenic
1008553736 6:52656078-52656100 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1008624745 6:53305399-53305421 CGCCCGGCAGCCACCCCGCCCGG - Intronic
1008909856 6:56720993-56721015 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1008909873 6:56721036-56721058 TGCCCGGCAGCTGCCCTGTCTGG - Intronic
1008909893 6:56721078-56721100 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1008909911 6:56721119-56721141 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1008919249 6:56824843-56824865 CGCCCCGCAGCCACCCCGTCCGG + Intronic
1009042050 6:58190830-58190852 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1009217867 6:60944978-60945000 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1009622679 6:66096859-66096881 TGCCCGGCAGCCGCCCCATCCGG - Intergenic
1010239261 6:73601340-73601362 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1010239272 6:73601380-73601402 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1010300611 6:74255124-74255146 TGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1010300619 6:74255164-74255186 TGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1010400594 6:75441952-75441974 CGCCCCGCAGCCACCCCGTCCGG - Intronic
1011426821 6:87239547-87239569 CGCCCGGCAGCCGCCCTGTCCGG - Intronic
1011640368 6:89411996-89412018 TGCCCACCGGCCGGCCGGCCCGG + Exonic
1012479377 6:99650269-99650291 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1013204469 6:107934129-107934151 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1013538833 6:111087830-111087852 GGCCGCTCCGCCGCCCGGCCCGG + Exonic
1013681326 6:112528445-112528467 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1014123411 6:117751069-117751091 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1014137661 6:117907619-117907641 CGGGCCGCGGCCGCCCGGCCGGG + Exonic
1014463692 6:121729834-121729856 TGCCCCGCTGCCACCCCGTCTGG - Intergenic
1016123569 6:140373744-140373766 TGCCCAGCAGCCACCCTGTCTGG - Intergenic
1016123621 6:140373867-140373889 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1016330534 6:142947574-142947596 GGCCGCGCCGCCGCCCTGCCCGG + Intergenic
1016476437 6:144433501-144433523 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1016479875 6:144470301-144470323 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1017063442 6:150507532-150507554 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1017493782 6:154966345-154966367 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1017982008 6:159407676-159407698 TGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1018013518 6:159693033-159693055 TGCCCCGGTCCCGCCAGGCCCGG + Intronic
1018852632 6:167652510-167652532 TTCCCCGCAGCCCCTCTGCCTGG - Intergenic
1018893228 6:167996864-167996886 TGCCCCTCTGCCCTCCGGCCAGG - Intronic
1019312540 7:369737-369759 TGCCCCACAACAACCCGGCCGGG + Intergenic
1019492240 7:1321030-1321052 TGCCCCGCAACAGCCTGGGCTGG + Intergenic
1019651544 7:2161862-2161884 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
1019662471 7:2232568-2232590 CGCCCCTCGGCCGCCCGCCCTGG + Intronic
1019714997 7:2534444-2534466 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1020142884 7:5622153-5622175 TGTACCGCAGCGGCCTGGCCTGG + Intronic
1020157290 7:5736877-5736899 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1020157305 7:5736917-5736939 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1020235012 7:6348626-6348648 TGATACGCAGCCGCCAGGCCAGG + Exonic
1020498878 7:8890679-8890701 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1021120398 7:16790199-16790221 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1021672472 7:23046572-23046594 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1022700359 7:32754047-32754069 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1022700445 7:32754252-32754274 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1023000421 7:35801777-35801799 CTCCCCGCCGCCGCCCGCCCGGG - Intronic
1023160572 7:37292705-37292727 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1023971244 7:44992616-44992638 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1024047135 7:45592563-45592585 TGTCTCACAGCCGCCCGGACAGG + Intronic
1024305146 7:47922708-47922730 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1024578364 7:50782585-50782607 TGCGCCGCAGGCCCCTGGCCGGG - Intronic
1024929995 7:54659479-54659501 CTCACCGCAGCCTCCCGGCCTGG - Intergenic
1024944005 7:54790872-54790894 TGCCACACAGACACCCGGCCAGG + Intergenic
1025793654 7:64718041-64718063 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1025796051 7:64738956-64738978 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1025808295 7:64856388-64856410 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1025828974 7:65033678-65033700 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1026868221 7:73836010-73836032 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1026909373 7:74083640-74083662 CGCCCCGCTGCGGCCCGGCCTGG - Intronic
1027371072 7:77509209-77509231 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1028227477 7:88266669-88266691 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1028535630 7:91887635-91887657 TGCCCGGCCGCCACCCCGCCTGG + Intergenic
1028535740 7:91888017-91888039 TGCCCGGCAGCTGCCCCGTCTGG + Intergenic
1029525714 7:101092545-101092567 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1029569291 7:101359414-101359436 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1029569302 7:101359454-101359476 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1029737688 7:102473749-102473771 TGCCCAGCATCCCCCCCGCCAGG + Intronic
1030036323 7:105410957-105410979 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1030288326 7:107848350-107848372 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1030329352 7:108255846-108255868 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1030329363 7:108255886-108255908 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1030602776 7:111610107-111610129 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1030706364 7:112697384-112697406 CGCCCGGCAGCCGCCCTGTCCGG - Intergenic
1031604200 7:123748940-123748962 CTCCCGGCACCCGCCCGGCCAGG + Exonic
1032028659 7:128463617-128463639 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1032028678 7:128463658-128463680 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1032156868 7:129476255-129476277 TGCCCGGCAGCCGCCCCGCCCGG - Intronic
1032274237 7:130440760-130440782 TGCCCCGCGGCCCCCAAGCCCGG + Intronic
1032391292 7:131556725-131556747 GGCCCCGGCCCCGCCCGGCCCGG - Intronic
1032418262 7:131755865-131755887 TGCCCGGCCGCCGCCCCGTCTGG - Intergenic
1032569537 7:132984820-132984842 CGCCCGGCAGCCACCCGGTCTGG + Intronic
1033090239 7:138378913-138378935 TGCCCGGTAGCCGCCCCGTCTGG - Intergenic
1033131083 7:138745898-138745920 TGCCCCACTGCCCTCCGGCCTGG + Intronic
1033323775 7:140362387-140362409 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1034219299 7:149431745-149431767 CCCGCCGCCGCCGCCCGGCCAGG - Exonic
1034234371 7:149555240-149555262 TGCCCGCCAGCCGCCCGTCTGGG + Intergenic
1034412300 7:150947821-150947843 GGCCCTGCCCCCGCCCGGCCCGG + Exonic
1034951007 7:155297417-155297439 AGACCCGCCGCCTCCCGGCCAGG + Intergenic
1035266000 7:157690604-157690626 CGCCCCGAGGCCGCTCGGCCCGG - Intronic
1035443899 7:158926476-158926498 GGCCCCGCATGTGCCCGGCCTGG - Intronic
1035612042 8:973311-973333 CGCCCGGCAGCCGCCCTGTCTGG - Intergenic
1036712688 8:11091718-11091740 TGCCCTGCAGCCGTGGGGCCGGG + Intronic
1036737194 8:11330033-11330055 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1037821810 8:22138767-22138789 TGTCCTGCAGGCCCCCGGCCCGG + Exonic
1038176224 8:25184362-25184384 CGCCCACCGGCCGCCCGGCCTGG + Intergenic
1039153356 8:34529281-34529303 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1039201101 8:35094662-35094684 TGCCCAGCCGCCGCCCGGTCTGG - Intergenic
1039620951 8:38996746-38996768 TGCCCGGCAGCCGACGGGGCGGG + Intronic
1039753123 8:40496348-40496370 TGCCCGGCCGCCACCCCGCCTGG - Intergenic
1039753160 8:40496465-40496487 TGCCTGGCAGCCGCCCCGTCTGG - Intergenic
1039961949 8:42255035-42255057 TGCCCAGCTGCCGCCCTGTCTGG + Intergenic
1040041248 8:42918941-42918963 TGCCCGGCCGCCACCCCGCCTGG - Intronic
1040041327 8:42919142-42919164 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1040041369 8:42919298-42919320 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1040043494 8:42939641-42939663 TGCCCGGCAGCCACCCCGTCCGG - Intronic
1040043604 8:42940070-42940092 TGCCCGGCCGCCGCCCCGTCTGG - Intronic
1040052802 8:43033044-43033066 CCCCCCCCAGCCGCCCCGCCCGG - Intronic
1040052833 8:43033134-43033156 TGCCTGGCAGCCGCCCCGTCTGG - Intronic
1040070107 8:43180683-43180705 TGCCCAGCAGCCACCCCGTCTGG - Intronic
1040093324 8:43419595-43419617 TGCCCGGCAGCCGCCCAATCTGG - Intergenic
1040121330 8:43687838-43687860 TGCCCAGCAGCCACCCCGTCTGG - Intergenic
1040517824 8:48148692-48148714 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1040599516 8:48870228-48870250 CGCGCCGCCACCGCCCGGCCGGG + Intergenic
1040834680 8:51719126-51719148 TGCCCTGCCGCCACCCGGTCTGG + Intronic
1040916995 8:52573605-52573627 TGCCCGGCAGCCGCCCCATCTGG - Intergenic
1041070755 8:54125362-54125384 TGCCCGGCAGCCACCCCGTCCGG + Intergenic
1041167366 8:55102739-55102761 CGCCCCGCCGCCGCCCGGGCCGG - Exonic
1041851092 8:62394654-62394676 TGCCCCGCTGCCGCCAGGTCTGG - Intronic
1042475686 8:69245812-69245834 TGCCCAGCAGCCACCCCGTCTGG + Intergenic
1042499482 8:69492605-69492627 TGCGCTGCAGCCGGCCGGCTTGG - Intronic
1042785054 8:72537242-72537264 CGCCCCGCAGCTAGCCGGCCCGG - Intergenic
1042859027 8:73294980-73295002 TGCAGCGGAGCCGGCCGGCCGGG + Exonic
1042912834 8:73844904-73844926 CGCCCGGCAGCCGCCCGGTCTGG + Intronic
1043961524 8:86423827-86423849 TGCCCAGCCGCCGCCCCGTCCGG - Intronic
1043961604 8:86424043-86424065 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1044223654 8:89698829-89698851 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1044660952 8:94591569-94591591 CGCCCGCCAGCCGCCCGTCCGGG + Intergenic
1044969445 8:97605153-97605175 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1045021933 8:98051872-98051894 TGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1045235706 8:100351166-100351188 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1045235782 8:100351445-100351467 CGCCCGGCAGCCGCCTGGTCTGG + Intronic
1046599251 8:116297735-116297757 TGCCCCGCCGCCACCCCGTCTGG + Intergenic
1046599274 8:116297812-116297834 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1046736036 8:117777709-117777731 TGCCCCGCCGCCACCCGGTCTGG + Intergenic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1046736079 8:117777866-117777888 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
1047266575 8:123314769-123314791 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1047499562 8:125430938-125430960 CGCCTCGCAGCCCCGCGGCCCGG + Exonic
1047687613 8:127317227-127317249 TGCCCGCCAGCCGCCCCGTCCGG + Intergenic
1047687636 8:127317275-127317297 CGCCCGCCAGCCGCCCGTCCGGG + Intergenic
1049583089 8:143421532-143421554 GGCCCCGCAGGCGCCTGGCCCGG - Intronic
1049583453 8:143422784-143422806 TGCCCCCCCGCCCCCCTGCCCGG + Intronic
1049852137 8:144838409-144838431 TGCTGGGCAGGCGCCCGGCCTGG + Intronic
1049891392 9:73513-73535 CGCCCTGCACCCGCCCGCCCGGG + Intergenic
1049892485 9:83462-83484 CGCCCAGCAGCCGCCCCGTCCGG - Intergenic
1049896881 9:117390-117412 TGCCCCGCCGCAGCCAGTCCCGG - Exonic
1049976004 9:861784-861806 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1050417825 9:5434133-5434155 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1050417924 9:5434437-5434459 TGCCCGGCCGCCGCCCCGTCTGG + Intronic
1050571879 9:6949124-6949146 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1051258085 9:15234230-15234252 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1051281052 9:15442409-15442431 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1051735623 9:20196324-20196346 TGCCCCGCAGCCCCCAAGGCTGG + Intergenic
1052259093 9:26492712-26492734 TGCCCGGCCGCCACCCGGTCTGG + Intergenic
1052413613 9:28149862-28149884 TGCCCAGCCGCCGCCCTGTCTGG + Intronic
1052928688 9:34039037-34039059 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
1053048132 9:34936906-34936928 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1053188217 9:36036974-36036996 GGCTCTGGAGCCGCCCGGCCCGG + Exonic
1053468016 9:38324822-38324844 CGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1053739984 9:41127642-41127664 TGCCCCGCCGCAGCCAGTCCCGG - Exonic
1054442948 9:65283636-65283658 TGCCCCGCCGCAGCCAGTCCCGG - Exonic
1054487332 9:65737865-65737887 TGCCCCGCCGCAGCCAGTCCCGG + Exonic
1054688366 9:68303671-68303693 TGCCCCGCCGCAGCCAGTCCCGG + Exonic
1054877477 9:70111986-70112008 TGCCCAGCAGTCTCCCAGCCAGG - Intronic
1055138748 9:72851507-72851529 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1055297914 9:74852899-74852921 TGCCCAGCAGCCACCCCGTCTGG + Intronic
1055298007 9:74853248-74853270 CGCCCGGCAGCCGCCCCGTCAGG + Intronic
1055948281 9:81710377-81710399 TGCCCAGCAGCCACCCCGTCCGG + Intergenic
1056097844 9:83272937-83272959 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1056097855 9:83272977-83272999 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1056135166 9:83623495-83623517 GGCCCCGCAGCCGCCTGTTCAGG - Intronic
1056152502 9:83804050-83804072 TGCCCGGCAGCCACCCCGTCTGG + Intronic
1056152513 9:83804090-83804112 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1056166799 9:83948270-83948292 CGCCCAGCAGCCGCCCCGCCTGG + Intronic
1056166814 9:83948310-83948332 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1056166847 9:83948396-83948418 AGCCCGGCAGCCGCCCCGTCCGG + Intronic
1056787501 9:89603787-89603809 GGCCACGGAGCTGCCCGGCCGGG - Intergenic
1056965302 9:91159989-91160011 CGGCCCGCACCCGCCCTGCCGGG + Intergenic
1057071831 9:92105753-92105775 TGCCCAGCCGCCGCCCTGTCTGG + Intronic
1057445383 9:95111050-95111072 CGCTCCCCAGCAGCCCGGCCAGG - Intronic
1057630465 9:96715678-96715700 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1057751506 9:97796641-97796663 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1058244123 9:102603276-102603298 TGCCCAGCAGCCACCCCGTCTGG - Intergenic
1058961781 9:109998721-109998743 TGCACCGCTGCCGTCCAGCCTGG + Intronic
1059118117 9:111617494-111617516 CGCCCGGCAGCCACCCCGCCCGG - Intergenic
1059123354 9:111661784-111661806 TCCCCCGCTGGCGCCCGGTCCGG - Intronic
1059217187 9:112575058-112575080 TGCCCTGCAGCTGCCTGGACAGG + Exonic
1059400208 9:114064819-114064841 TGCCCTGCAACCTCCAGGCCTGG + Intronic
1059470933 9:114504715-114504737 GCCCCCGCCGCCGCCCGCCCCGG + Exonic
1060080157 9:120636787-120636809 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1060080177 9:120636828-120636850 CGCCCGGCAGCCGCCCCGTCTGG + Intronic
1060350119 9:122852374-122852396 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1060544697 9:124453081-124453103 GGCTCCGCAGCCGCGCCGCCCGG - Exonic
1060625609 9:125108749-125108771 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1060687068 9:125623673-125623695 TGCCCAGCAGCCACCCCGTCCGG + Intronic
1060703899 9:125780794-125780816 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1060703910 9:125780834-125780856 TGCCCGGCAGCCACCCCGTCTGG - Intronic
1061127053 9:128683776-128683798 TGCACTGGAGCCGCCCTGCCTGG - Exonic
1061216236 9:129223631-129223653 TGGCCTGCAGCCTCCAGGCCAGG + Intergenic
1061424628 9:130491316-130491338 GGCCCCGGAGCAGCCCGGCCAGG - Intronic
1061427237 9:130506943-130506965 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
1061609985 9:131739836-131739858 CGCCCCGCGGCGGCCCGGCCCGG - Intronic
1061635841 9:131908055-131908077 CGCCCGGCAGCCACCCGGTCTGG + Intronic
1061725594 9:132580483-132580505 GGCCCCGCCGCCGGCCGGGCTGG - Intergenic
1061977307 9:134075916-134075938 GGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1062022651 9:134326671-134326693 GGCCCCGTCCCCGCCCGGCCCGG - Intronic
1062179634 9:135184340-135184362 TGCCCAGCAGCCTCCGGGCAAGG + Intergenic
1062305939 9:135907253-135907275 GGCCCCGCAGCCGGCCAGCCGGG + Intergenic
1062499340 9:136845595-136845617 ACCCGCGCAGCAGCCCGGCCTGG + Exonic
1062550960 9:137086379-137086401 AGCCCGGGTGCCGCCCGGCCTGG + Intergenic
1203634425 Un_KI270750v1:97327-97349 TGCCCGGCAGCCACCCTGTCTGG - Intergenic
1185747530 X:2584416-2584438 AGCCCAGCGGCCGCCGGGCCCGG - Intergenic
1186922957 X:14302696-14302718 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1186922968 X:14302736-14302758 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1188214399 X:27458895-27458917 TGCCCGGCGGCCGCCCCGTCTGG + Intergenic
1188214414 X:27458935-27458957 TGCCCGGCGGCCGCCCTGTCTGG + Intergenic
1189323090 X:40097874-40097896 TCCCCCGCAGCCGCCGAGCTCGG + Intronic
1189825269 X:44911225-44911247 CGCCCGGCAGCCGCCCCGTCCGG - Intronic
1189882066 X:45503892-45503914 TGCCCAGCAGCCACCTGGTCTGG - Intergenic
1189968631 X:46396314-46396336 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1190153182 X:47965700-47965722 TGCCCGGCTGCCGCCCTGTCTGG + Intronic
1190159023 X:48016984-48017006 TGCCCCGCCGCCACCCCGTCTGG + Intronic
1190174728 X:48139249-48139271 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190184539 X:48222549-48222571 CGCCCGGCAGCCGCCCCGTCCGG + Intronic
1190505055 X:51119182-51119204 TGCCCGGCCGCCGCCCTGTCCGG - Intergenic
1190769620 X:53504205-53504227 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190793599 X:53721776-53721798 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190793663 X:53721944-53721966 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1190906828 X:54736593-54736615 TGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1190906837 X:54736633-54736655 TGCCCAGCAGCCGCCCTATCCGG + Intergenic
1191828733 X:65392603-65392625 CGCCCAGCAGCCGCCCCGTCTGG + Intronic
1191894148 X:65975232-65975254 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
1191894230 X:65975436-65975458 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1192324807 X:70123121-70123143 TGCCCCGCTGCCACCCCGTCTGG + Intergenic
1192350078 X:70349490-70349512 TGCCCGGCAGCCGCCCCGTCTGG - Intronic
1192352859 X:70371722-70371744 CGCCCAGCAGCCGCCCCGTCCGG - Intronic
1192476992 X:71452219-71452241 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1192500146 X:71645143-71645165 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1192500157 X:71645183-71645205 CGCCCAGCAGCCGCCCCGTCTGG - Intergenic
1192500181 X:71645260-71645282 TGCCCCGCCGCCACCCCGTCTGG - Intergenic
1192505039 X:71676318-71676340 TGCCCGGCCGCCGCCCCGTCTGG + Intergenic
1192551217 X:72055258-72055280 TCCCCAGCAACCGCCAGGCCGGG + Intergenic
1192658866 X:73021728-73021750 TGCCTGGCAGCCGCCCTGTCTGG - Intergenic
1192761316 X:74098567-74098589 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1192768533 X:74166548-74166570 TGCCCGGCAGCCACCCCGTCTGG + Intergenic
1192768544 X:74166588-74166610 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1192794177 X:74412704-74412726 CGCCCGGCAGCCGCCCCGTCCGG - Intergenic
1192813455 X:74568780-74568802 TGCCCGGCAGCCACCCCGTCCGG - Intergenic
1193114845 X:77766379-77766401 TGCCCCGCTGCCACCCCGTCTGG - Intronic
1193164633 X:78265678-78265700 TGCCCGGCAGCCACCCCGTCTGG - Intergenic
1193328959 X:80215140-80215162 CGCCCAGCAGCCGCCCCGTCCGG + Intergenic
1193924367 X:87466110-87466132 TGCCCGGCAGCCGCCCCATCTGG + Intergenic
1194181195 X:90713826-90713848 CGCCCTGCAGCCGCCCCGTCTGG + Intergenic
1194350618 X:92821749-92821771 TGCCCGGCCGCCGCCCCGACTGG + Intergenic
1194714658 X:97275436-97275458 CGCCCGGCAGCCGCCCCGTCTGG - Intronic
1195370270 X:104166492-104166514 CGCAGCGCCGCCGCCCGGCCCGG - Intergenic
1195654713 X:107323804-107323826 TCCCCCGCAGCCTGCCGCCCTGG + Intergenic
1195888939 X:109671305-109671327 TGCCCCGCCGCCGCCCCGTCTGG + Intronic
1196778536 X:119362153-119362175 TGCCCAGCAGCCACCCTGTCTGG + Intergenic
1196819571 X:119692461-119692483 GGCGCCGCCGCCGCCCGCCCGGG + Intronic
1197455691 X:126674056-126674078 CGCCCGGCAGCCGCCCCGTCTGG + Intergenic
1197455702 X:126674096-126674118 CGCCCGGCAGCCGCCCCGTCCGG + Intergenic
1198108628 X:133483849-133483871 CGCCCGGCAGCCGCCCAGTCCGG - Intergenic
1198189148 X:134286065-134286087 CGCCCGGCAGCCGCCCCGTCTGG - Intergenic
1198246876 X:134839532-134839554 TGCCCGGCAGCCACCCCGTCCGG + Intronic
1198321298 X:135521231-135521253 TGCCCCGCAGCTGCGCGCCCGGG + Exonic
1199836748 X:151599463-151599485 CGCCCGGCAGCCGCCCAGTCCGG - Intronic
1199836783 X:151599580-151599602 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1199979968 X:152915429-152915451 TGCCCCACAGCCACACAGCCAGG - Intronic
1200100747 X:153688280-153688302 GCCGCCGCCGCCGCCCGGCCGGG + Exonic
1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG + Intronic
1200142189 X:153907819-153907841 CGCCCAGCAGCCGCCTGGGCAGG - Exonic
1200147627 X:153934820-153934842 TGCGCGGCAGCCACCCGGCCCGG + Intronic
1200149665 X:153944920-153944942 AGGCCCTCAGCCGCCCTGCCGGG - Intergenic
1200324612 X:155223957-155223979 TGCCCCGCCGCCACCCCGTCTGG - Intronic
1200387420 X:155907797-155907819 CGCCCAGCAGCCGCCCCGTCTGG - Intronic
1200527823 Y:4295755-4295777 CGCCCTGCAGCCGCCCCGTCTGG + Intergenic
1200658945 Y:5938429-5938451 TGCCCGGCCGCCGCCCCGACTGG + Intergenic
1200952878 Y:8918084-8918106 TGCCCGGCCGCCGCCCCGTCCGG - Intergenic
1200952908 Y:8918170-8918192 CGCCCGGCAGCCGCCCAGTCTGG - Intergenic
1201948264 Y:19535722-19535744 TGCCCAGCAGCCGCCCCGTCTGG + Intergenic
1202028862 Y:20552117-20552139 TGCCCGGCCGCCGCCCTGTCTGG + Intergenic