ID: 951221164

View in Genome Browser
Species Human (GRCh38)
Location 3:20070150-20070172
Sequence TGTATTAATGAGGATGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951221164_951221169 -3 Left 951221164 3:20070150-20070172 CCTTCTCCATCCTCATTAATACA 0: 1
1: 0
2: 0
3: 37
4: 320
Right 951221169 3:20070170-20070192 ACAAAATGGGAAAAGCAGTCAGG 0: 1
1: 0
2: 3
3: 61
4: 1367
951221164_951221170 2 Left 951221164 3:20070150-20070172 CCTTCTCCATCCTCATTAATACA 0: 1
1: 0
2: 0
3: 37
4: 320
Right 951221170 3:20070175-20070197 ATGGGAAAAGCAGTCAGGTTAGG 0: 1
1: 0
2: 0
3: 27
4: 414
951221164_951221171 20 Left 951221164 3:20070150-20070172 CCTTCTCCATCCTCATTAATACA 0: 1
1: 0
2: 0
3: 37
4: 320
Right 951221171 3:20070193-20070215 TTAGGTATTCCAGATTCACATGG 0: 1
1: 0
2: 1
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951221164 Original CRISPR TGTATTAATGAGGATGGAGA AGG (reversed) Intronic
900718436 1:4159866-4159888 TGCAATAATAATGATGGAGAAGG + Intergenic
906196353 1:43932906-43932928 TGTAGTAAAGAGGATGGGGTTGG - Intergenic
907427898 1:54392619-54392641 CGTTTTAATGAAGATGGACAAGG - Intronic
907503506 1:54901017-54901039 TGTATTGATTAAGAAGGAGACGG + Intergenic
908160430 1:61402536-61402558 GGTATTTACGAAGATGGAGAAGG + Intronic
908359497 1:63354921-63354943 GGTTTTAATGAGAAAGGAGACGG - Intergenic
908733801 1:67254999-67255021 TTTCTTGATGCGGATGGAGAAGG - Intronic
910147760 1:84102624-84102646 TGTATTAATGTTGATTGAAAGGG + Intronic
910394037 1:86774135-86774157 TTTTTTAATGGGGATGGAGGGGG - Intergenic
910693889 1:89992317-89992339 TGAATCAATCAGGATGGAGGAGG + Intergenic
912203824 1:107488492-107488514 TGTATTATTTAGAATAGAGATGG - Intergenic
914222968 1:145696815-145696837 TGTAGTCATGAGGAATGAGATGG + Intronic
915023444 1:152804189-152804211 TAATTTAATGAAGATGGAGAAGG + Intronic
917216667 1:172686020-172686042 TCTATTAATGAGGCTGGGCATGG - Intergenic
917430162 1:174958454-174958476 TGTATTGATATGGAGGGAGAAGG - Intronic
917508597 1:175650896-175650918 GGTAGTAATGAGGTGGGAGAGGG - Intronic
917621019 1:176795959-176795981 TGTTTTAAAGAGAAGGGAGAAGG + Intronic
918682852 1:187377059-187377081 TGTATTAAGAAAGATGCAGAGGG - Intergenic
921431940 1:215076110-215076132 TGTGTTAATGAGAAGGGAGTTGG - Intronic
922192209 1:223329209-223329231 TGTATTTATCATCATGGAGAAGG + Intronic
922654764 1:227372298-227372320 TGTATCCATGTGGATGTAGATGG - Intergenic
923356354 1:233159869-233159891 TGAAATGATGGGGATGGAGAAGG - Intronic
1062975624 10:1680389-1680411 TGTATGTATGTGGGTGGAGAAGG - Intronic
1064841129 10:19593388-19593410 TGGTTTAGTGAGGAGGGAGAGGG + Intronic
1065452722 10:25875386-25875408 TGTATTAATCAGGATGCACCAGG - Intergenic
1066332086 10:34434690-34434712 AGTAGTAATGAAGATGCAGAGGG + Intronic
1068216057 10:53983903-53983925 TTTTTTCAGGAGGATGGAGAGGG - Intronic
1068311973 10:55290570-55290592 TATATTAAAGAGGTTGGAGTTGG - Intronic
1068756853 10:60665136-60665158 TTTATTGATGAGGAGGCAGAGGG - Intronic
1069551731 10:69368776-69368798 TGGAATGATGAGGATGGGGATGG + Intronic
1070172498 10:73943243-73943265 TGTATTACTCAGGATAGTGATGG - Intergenic
1070201481 10:74209886-74209908 TGTATTAATAGGGATGAAAAAGG + Intronic
1070529221 10:77321925-77321947 TGCATTAATCAGGATAGACAAGG + Intronic
1070690130 10:78518268-78518290 TGAATTAATGAGAAAGGATAGGG + Intergenic
1071287223 10:84160063-84160085 TGTATTTATGGTGATGGATATGG + Intergenic
1072732130 10:97853328-97853350 GTTTTTAATGAGGATGAAGATGG + Intronic
1073761549 10:106634082-106634104 TGTATTAATAAGGCTGGGAATGG + Intronic
1074645035 10:115439976-115439998 CAAATTAATGAGGAAGGAGAAGG - Intronic
1076941599 10:133613729-133613751 TTTATTAATGATGACGGAGAGGG + Intergenic
1077552483 11:3207061-3207083 GGTAGTAATGATGATGGTGATGG + Intergenic
1078399914 11:11016921-11016943 TGAATTAGTGAAGATGGGGAGGG + Intergenic
1079063088 11:17266737-17266759 TCTATTAACGAGGAAGAAGAGGG - Intronic
1079496985 11:21055886-21055908 GGTAATAATGAGGATGGGAAAGG + Intronic
1079911396 11:26314926-26314948 TGGCTTGATGATGATGGAGAAGG - Intronic
1080701082 11:34644646-34644668 TGAATGAATGAGGAAGAAGAGGG + Intronic
1081004280 11:37714874-37714896 TGTAGTAATGGGGAAGTAGATGG + Intergenic
1085365977 11:75945245-75945267 TGTATTTCTGAGGAAGGAAAGGG + Intronic
1085865190 11:80282431-80282453 TATGTTAATGAGGTGGGAGATGG - Intergenic
1087560999 11:99790467-99790489 TGTAGCAATGTGGATGGAGCTGG - Intronic
1087603933 11:100351560-100351582 TGTAATAATGATGGTGGTGATGG - Intronic
1089464822 11:118678261-118678283 TGTGTTAGAGAGGATGGGGAGGG - Intronic
1089466874 11:118691166-118691188 TGTGTTAGAGAGGATGGGGAGGG - Intergenic
1089914653 11:122141768-122141790 TGCATTAAGGAGGGTGGAGGAGG - Intergenic
1090711481 11:129390317-129390339 TGTATTTATGAAGAGTGAGAAGG + Intronic
1092822035 12:12361698-12361720 TGAATGAATGAGGTTGGAAATGG + Intronic
1095566563 12:43631194-43631216 TGTGAAAATGAAGATGGAGAAGG + Intergenic
1095833166 12:46609122-46609144 TGTGGTAAGGAGGAAGGAGAAGG - Intergenic
1095929114 12:47608025-47608047 TGAACTGATGAGGATGAAGAAGG - Intergenic
1096372102 12:51077396-51077418 TATACTAATAAGGATGGTGAAGG + Intronic
1096452052 12:51751502-51751524 TGTATTCAGGACGATGCAGATGG - Exonic
1096942557 12:55363568-55363590 AATTTGAATGAGGATGGAGAAGG + Intergenic
1099865628 12:88277025-88277047 GATATTAATGATGATGAAGATGG - Intergenic
1100608377 12:96170162-96170184 TGTATTGAGGAGGATGGGCAGGG + Intergenic
1100737600 12:97554333-97554355 CGTATTAATGATTATGCAGAAGG + Intergenic
1102354695 12:112222946-112222968 TGCATTCATGAGGCTGGGGAGGG + Intronic
1102617313 12:114165902-114165924 TGTGGTTATGAGGTTGGAGATGG - Intergenic
1103535438 12:121630508-121630530 TTTTTTAATGTGTATGGAGATGG + Intronic
1104337652 12:127915069-127915091 TGTATTAATGGGGGTGCTGATGG + Intergenic
1104413727 12:128580676-128580698 GGCATTGATCAGGATGGAGAAGG + Intronic
1105641421 13:22268930-22268952 TGTAGGAATGAGGATGCACATGG + Intergenic
1106394462 13:29366955-29366977 TGTATTAAGGAGGAGGCAGAGGG - Intronic
1107155774 13:37165545-37165567 TGTATTAAAGCAGATGGAGCTGG - Intergenic
1107428746 13:40319544-40319566 TGTATTAAGGAGTATGGTAAAGG + Intergenic
1108919487 13:55658128-55658150 TGTATTGATGAAGAAGGGGACGG + Intergenic
1108928569 13:55786011-55786033 TGTAGTAATTTGGATGGAGCTGG - Intergenic
1109462509 13:62680119-62680141 TGTATGCATGTGGAGGGAGATGG - Intergenic
1109877195 13:68420830-68420852 TGCAGTAATGTGGATGGAGCTGG - Intergenic
1109877737 13:68428116-68428138 TTTATTAATGAGGAAGAAGAAGG + Intergenic
1111284849 13:86075799-86075821 TTAATAAATGAGGATGGAGAAGG + Intergenic
1111587128 13:90296117-90296139 TCTATTAATAAGAATTGAGAAGG - Intergenic
1111686147 13:91502931-91502953 TGTATTTAGGAGAATGGATATGG + Intronic
1111949246 13:94697442-94697464 TGTACTAAAGAAGAAGGAGAAGG - Intergenic
1112571506 13:100597629-100597651 TGTATTAATCAGGATAACGATGG + Intergenic
1112586904 13:100726701-100726723 GGTATGAATTTGGATGGAGATGG + Intergenic
1112588542 13:100742261-100742283 TGCATTAATAAGTATGGTGAAGG - Intergenic
1114765999 14:25371135-25371157 TGTATTAATGAGGAAGCAGGAGG - Intergenic
1116569221 14:46494086-46494108 AGTATTAATGATGATGCAGAGGG - Intergenic
1116833488 14:49746036-49746058 AGTATCAATGGGGCTGGAGAAGG + Intronic
1116869906 14:50060967-50060989 TGTCTGAATGGGGCTGGAGATGG + Intergenic
1117062405 14:51976485-51976507 TGTATTTATGAGGCTGGGCATGG - Intronic
1118870805 14:69739753-69739775 GGTATCAAAGAGGGTGGAGATGG + Intronic
1119021610 14:71120877-71120899 GGAATTAATGTGGATAGAGAGGG + Intergenic
1119047527 14:71332725-71332747 TGAATGAATGAAGATGCAGAAGG - Intronic
1120795877 14:88632337-88632359 TATATTATTGAGAATGTAGAGGG - Intronic
1121583907 14:95049872-95049894 TGGATGGATGAGGATGTAGAAGG + Intergenic
1121587987 14:95077003-95077025 TTTATAGATGAGGAAGGAGATGG + Intergenic
1121699099 14:95938553-95938575 TTTCTTGATGAGGATGGTGAAGG - Intergenic
1121773148 14:96570277-96570299 TGTATGTATGGGGATTGAGAGGG - Intergenic
1122120411 14:99550345-99550367 TGTAATACTGAAGATGGGGAAGG + Intronic
1123126886 14:105953152-105953174 TGTAATTATGAGGCTGGAGGTGG + Intergenic
1125968522 15:43893543-43893565 TGCATGAATGGTGATGGAGAGGG + Intronic
1126381135 15:48048389-48048411 TGTAATAATGGGGGTGGAAAAGG - Intergenic
1126384478 15:48079971-48079993 TGTATAAATGTGGCTGGACAGGG - Intergenic
1126449368 15:48789106-48789128 TGTTTTAATGAGAGTAGAGAAGG + Intronic
1131058069 15:89387966-89387988 TGTATTTATGTGGCTGTAGATGG + Intergenic
1132212775 15:100036738-100036760 AGTGCTAATGAGGAGGGAGAGGG - Intronic
1133121304 16:3610339-3610361 GGGATTAACGGGGATGGAGACGG - Intronic
1133838835 16:9390071-9390093 TCTATTAGTGAGGATGAAGGGGG + Intergenic
1134181112 16:12048549-12048571 AGGTTTGATGAGGATGGAGACGG - Exonic
1134613428 16:15629634-15629656 AGAATTAATGATAATGGAGAAGG - Intronic
1135307848 16:21382304-21382326 AGGTTTGATGAGGATGGAGATGG - Intergenic
1135804083 16:25526273-25526295 AGTATTAATGTGGAAGGTGAAGG + Intergenic
1136304593 16:29361424-29361446 AGGTTTGATGAGGATGGAGATGG - Intergenic
1138001157 16:53281299-53281321 TATATTTACTAGGATGGAGAAGG - Intronic
1138170366 16:54843818-54843840 TGTATTAAAAATGGTGGAGAGGG + Intergenic
1138834677 16:60419862-60419884 TGTATTAATCAGAATAGAGTGGG + Intergenic
1140203956 16:72918288-72918310 TGCATTCAGGAGGATGGGGACGG + Intronic
1140653236 16:77111641-77111663 TCTATTAATGAGCATGGAGGAGG - Intergenic
1144046429 17:11458506-11458528 TGTGCTAATGAGGATGGATGAGG + Intronic
1144632295 17:16880457-16880479 TGCAGTGATGAGGATGTAGAGGG - Intergenic
1144638022 17:16923410-16923432 TGCAGTAATGAGGATGTGGAGGG - Intergenic
1145767617 17:27469970-27469992 TGGATCAAAGAGCATGGAGATGG + Intronic
1145772780 17:27505366-27505388 TGGGTTAATGAGGACAGAGAAGG - Intronic
1145872180 17:28283849-28283871 TGTATGTCTGAGGAGGGAGATGG - Intergenic
1146771441 17:35571994-35572016 TTTACTAATGAGGAAGGACATGG - Intergenic
1149498772 17:57135759-57135781 TGTAATGATGCTGATGGAGAGGG - Intergenic
1150444719 17:65219954-65219976 TGTATTAATGGTGATGGTGATGG - Intronic
1150444731 17:65220081-65220103 TGTATTAATGGTGATGGTGATGG - Intronic
1150627192 17:66849232-66849254 TGCATCCATCAGGATGGAGACGG - Intronic
1150903284 17:69307799-69307821 TGTATGAATAATGATGGAGCTGG - Intronic
1150992226 17:70272657-70272679 TGAATTAATGAAGATCGATAGGG - Intergenic
1152486189 17:80595214-80595236 TGTAACAATGAGCATGCAGATGG + Intronic
1153341390 18:3978294-3978316 TGTCTTCATGACCATGGAGAAGG - Intronic
1154062759 18:11078848-11078870 TGTGTTACTGAGAATGGAGAGGG + Intronic
1155339729 18:24801813-24801835 TGTATAAATGAGGATTGAAAAGG + Intergenic
1155354553 18:24938888-24938910 TTTAATAATGTGGGTGGAGATGG + Intergenic
1155463248 18:26107230-26107252 TGCAGTAATGTGGATGGAGCTGG - Intergenic
1155661779 18:28257901-28257923 TGGAATAATGGTGATGGAGAGGG + Intergenic
1155846439 18:30713689-30713711 TGTATTCATGAGGAAGACGAAGG - Intergenic
1156193242 18:34744270-34744292 TGAATCAGTGAGGATGGAGAGGG - Intronic
1156828392 18:41461592-41461614 TGTATTAGGGAGTAAGGAGAGGG + Intergenic
1157448778 18:47769481-47769503 TGTATGAATGTCTATGGAGAGGG - Intergenic
1158852336 18:61507474-61507496 TATACTATTGTGGATGGAGATGG + Exonic
1159053418 18:63442686-63442708 AGTATTAAAGTGTATGGAGATGG + Intergenic
1161873494 19:6889165-6889187 TGTGATAATGACGATGAAGATGG + Intronic
1161957897 19:7506490-7506512 TGGATAAGAGAGGATGGAGAAGG - Intronic
1162944829 19:14036452-14036474 TGTAACAATGTGGATGGAAATGG - Intronic
1163077659 19:14909401-14909423 TGGATTGTTGATGATGGAGACGG - Intergenic
1163306766 19:16484855-16484877 TTCATTAATGAGGATGGATGTGG + Intronic
1166148570 19:40853772-40853794 TGTATAAATGAGGATAAACATGG - Intronic
1166152709 19:40885555-40885577 TGTATAAATGAGGATAAACATGG - Intronic
1166333991 19:42094584-42094606 TATATGAATGAGGTTGGGGAAGG - Intronic
1166542215 19:43612821-43612843 TTCCTTGATGAGGATGGAGATGG - Exonic
1167325542 19:48822499-48822521 TGTGGTAATGACGATGGTGATGG + Intronic
1167452497 19:49580387-49580409 TGTATTAATAATGATTGACAGGG + Intronic
1168380341 19:55915236-55915258 TGGATTAAGGAGGTTCGAGATGG + Intronic
925823453 2:7823128-7823150 TCAATTAATTAGGATTGAGATGG - Intergenic
926582522 2:14646836-14646858 TGTTTTAATGAGAATGGTCATGG - Intronic
927389086 2:22572790-22572812 TGACTTAAGGAGGATGGGGAAGG - Intergenic
927500460 2:23579511-23579533 GGTAGTAATGAGGATGGCGAGGG - Intronic
927623854 2:24691639-24691661 TCAATTCAAGAGGATGGAGAAGG + Exonic
929087317 2:38181333-38181355 GGTTTTAATGAGCATGGAGAAGG - Intergenic
930271666 2:49264439-49264461 AGTTTTAAGCAGGATGGAGATGG + Intergenic
931639956 2:64373274-64373296 TGTTTTAATGAGGGTGGGCAGGG + Intergenic
932716480 2:74103575-74103597 TATATTAAAGTGGATGAAGAGGG - Exonic
932827141 2:74951883-74951905 TGTAATAACGTGGATGGAGCTGG + Intergenic
933185820 2:79278322-79278344 TGTATTAATGAGGAGAGACGGGG + Intronic
933917592 2:87011823-87011845 TGAATTATTGGGGATGGAGGAGG + Intronic
934005404 2:87758094-87758116 TGAATTATTGGGGATGGAGGAGG - Intronic
935081747 2:99804777-99804799 TGTAGCAATGTGGATGGAGCTGG + Intronic
935768363 2:106392186-106392208 TGAATTATTGGGGATGGAGGAGG - Intronic
935957902 2:108396987-108397009 TTTCTTAAAGAAGATGGAGAAGG - Intergenic
936511405 2:113150426-113150448 TGAATCAATGAGCATGGAGGAGG - Intergenic
937631328 2:124105060-124105082 TGTATTAAAAAGGAGGGAGGAGG - Intronic
941530216 2:166660609-166660631 AGTACAAATGAAGATGGAGAAGG + Intergenic
941650059 2:168082853-168082875 TGTCAGAATGAGGCTGGAGATGG - Intronic
942654476 2:178200649-178200671 TATATTTTTGAGGATGGTGATGG + Intronic
944499522 2:200344365-200344387 TGTGTAAATGTGGATGGAGCTGG - Intronic
945273076 2:207961231-207961253 TTTATTGATGAAGATGGAGAAGG + Intronic
945368393 2:208985254-208985276 TGAAATAAGGAGGTTGGAGATGG + Intergenic
946403631 2:219481612-219481634 TGAATGAATGAGGATTAAGAAGG - Intronic
948265470 2:236632543-236632565 TGTGTTCCTGAGGAGGGAGATGG + Intergenic
1168743980 20:220320-220342 GGTCTTAAAGAGGATGTAGAGGG + Intergenic
1169937383 20:10898567-10898589 TGCATGAATGAGTATGGAGCAGG - Intergenic
1170996805 20:21369210-21369232 TGTAACAATGTGGATGGAAACGG - Intronic
1176953926 21:15078157-15078179 TGTTTTAATCAAAATGGAGAAGG - Intergenic
1177735034 21:25078525-25078547 TGTATTAATGAGTAAGTAGGTGG - Intergenic
1178305683 21:31488359-31488381 TGTATTCAGGGGGATGGGGAGGG + Intronic
1178438152 21:32577545-32577567 TGGGTTGATGTGGATGGAGAAGG - Intronic
1179100748 21:38353733-38353755 TTTATTAAAGAAGATGGAGAAGG - Intergenic
1181904017 22:26178816-26178838 GGTAGTGATGAGGATGAAGAGGG + Intronic
1181982318 22:26773873-26773895 TGTATTCATCAGGATGCATAAGG + Intergenic
1183113229 22:35668640-35668662 CGAAGGAATGAGGATGGAGATGG - Intergenic
1184274314 22:43401478-43401500 AGTATGAATGCAGATGGAGAGGG + Intergenic
1184519750 22:44986397-44986419 GGTGGTAATGAGGATGGTGATGG - Intronic
1184870761 22:47236788-47236810 TGATTTAATGATGATGGTGATGG + Intergenic
950943579 3:16920604-16920626 GCTATTGATGAGGATGGAGAGGG + Intronic
951096759 3:18641304-18641326 TCTATTAAGGATGAGGGAGATGG - Intergenic
951221164 3:20070150-20070172 TGTATTAATGAGGATGGAGAAGG - Intronic
951719907 3:25687583-25687605 TGATTTGAAGAGGATGGAGAAGG - Intergenic
952553013 3:34500417-34500439 GATATTCCTGAGGATGGAGAAGG + Intergenic
955759801 3:62267067-62267089 TGTATTAATGGGGAGGGAACAGG + Intronic
956327944 3:68073783-68073805 GGTAGTAATGATGATGGTGATGG + Intronic
956485440 3:69717416-69717438 TGTGTAAATGTGTATGGAGAGGG + Intergenic
957248128 3:77738331-77738353 TGAATTATTGAGGAGAGAGAGGG - Intergenic
957258245 3:77866528-77866550 TATATTGATGATGATGGTGATGG - Intergenic
957473270 3:80689435-80689457 TGTATTATTGATGGTGCAGATGG - Intergenic
960284310 3:115810083-115810105 TGTATCATTCAGGATGGAGAAGG - Exonic
960552077 3:118987100-118987122 TGTATTTGTAAGGATGGTGATGG - Intronic
961518271 3:127451921-127451943 TGTGACAATGAGAATGGAGAAGG - Intergenic
961535225 3:127566682-127566704 TGCATTTATGAGGATGATGAGGG + Intergenic
961726430 3:128933899-128933921 TGTATTAATGAAGGAGGAGGAGG - Intronic
962511160 3:136102026-136102048 TGCATGGATGTGGATGGAGACGG + Exonic
962671042 3:137708937-137708959 TGTTGGAAAGAGGATGGAGAAGG + Intergenic
962978595 3:140467734-140467756 TATAGTAACAAGGATGGAGAAGG - Intronic
963111784 3:141694451-141694473 TGTATTAATTAAGAAGGGGACGG + Intergenic
963292271 3:143503951-143503973 TGTATTAACTACCATGGAGAAGG - Intronic
965469420 3:169072451-169072473 TGTATTAATCAGGATAGATTAGG + Intergenic
966321723 3:178708309-178708331 TGTAATAATGATAATGGTGATGG + Intronic
966548563 3:181179530-181179552 TGTTTTAATGAGGAGAGAAAGGG - Intergenic
970721174 4:18990848-18990870 TGTATCAATCAGGATGGATTAGG + Intergenic
970909594 4:21259215-21259237 TGTTTTAATGAGGTAGGAGTGGG - Intronic
972975267 4:44626739-44626761 TGTGCTAATGAGGATGGAATAGG - Intronic
975190346 4:71453124-71453146 TGAATGAATGAGGGTGGAAAGGG + Intronic
975699138 4:77045403-77045425 TGTATTAGTTTGGAGGGAGAAGG - Intergenic
977306531 4:95329897-95329919 TCTACTAATGATGATGGTGATGG + Intronic
978759982 4:112346485-112346507 TGAATCAATGAAGATGGAGTAGG - Intronic
979033813 4:115685868-115685890 TGTAGTGACGTGGATGGAGATGG - Intergenic
979126513 4:116980039-116980061 TGTATTCCAGAGGAAGGAGAGGG - Intergenic
979418313 4:120471568-120471590 TGTATAAAGGAGTATTGAGAGGG - Intergenic
980162966 4:129188429-129188451 TGTATCAATCAGGATGCATAGGG - Intergenic
980664541 4:135913116-135913138 TGTATTACTAAGTATGAAGAAGG + Intergenic
982649645 4:158071686-158071708 GGTACTATTGAGGGTGGAGATGG + Intergenic
983522699 4:168727021-168727043 TGCAGTAATGTGGATGGAGCTGG - Intronic
984411783 4:179405770-179405792 TGTATTGATTAAGAAGGAGATGG - Intergenic
984490580 4:180430292-180430314 AGTATTAATGAGGGTGGAATGGG - Intergenic
985078954 4:186245268-186245290 TGTATTAATTAAGAAGGGGATGG + Intronic
985673939 5:1220685-1220707 TGCATAAATCAGGATGGAGCAGG - Intronic
987401279 5:17479763-17479785 TGTATTCATTAGCATAGAGATGG + Intergenic
987457003 5:18159695-18159717 TGTATTAATGAGGATACTGTGGG - Intergenic
989330458 5:40252096-40252118 TGTAGTAATGTGGATGGAACTGG - Intergenic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
991023854 5:62008742-62008764 TGTGTTAATGGGGATGGAGTGGG - Intergenic
991411283 5:66347953-66347975 TGTATGGATGAGGCTGGAGAAGG - Intergenic
991557501 5:67912089-67912111 AGAATTAATAAGGATGGACAAGG + Intergenic
992168744 5:74081196-74081218 TGTATTCATGAGAATGGGCAAGG - Intergenic
993031397 5:82710057-82710079 TGTATTAAGAAGCAGGGAGAAGG + Intergenic
993070998 5:83163312-83163334 TGAATAAATGAGAATTGAGAAGG + Intronic
993398284 5:87417645-87417667 TGTATTGATGCTGATGGAGAGGG + Intergenic
993629391 5:90266812-90266834 AGAATTAATGAGGATTGAGAAGG + Intergenic
994057955 5:95441053-95441075 TTTACTAATGAGGATGGTGGTGG - Intronic
994199997 5:96962671-96962693 TGAAGCAATGAGGGTGGAGAAGG + Intronic
994217159 5:97150870-97150892 TATTTTAATGAGGAAGGAGTGGG - Intronic
995434994 5:112125551-112125573 TTTATAAATGAGGAAGCAGAGGG - Intergenic
996092006 5:119360643-119360665 TGTATTAAAGAGGATAGAAAGGG - Intronic
996132765 5:119801888-119801910 TGTAATGGTGAGGATGGATAAGG - Intergenic
997591931 5:135079341-135079363 TGTTTGAAGGAGGGTGGAGATGG + Intronic
997801645 5:136868677-136868699 TGTTTGCATGAGGGTGGAGAGGG - Intergenic
998252540 5:140562523-140562545 GGAATTAATAAGGATGGAGTAGG + Intronic
1000102150 5:158026318-158026340 TCTATAAATGGGGATGGAGGTGG + Intergenic
1001203260 5:169738386-169738408 GGTACTGATGAAGATGGAGAGGG + Intronic
1004071790 6:12305416-12305438 GGTAGTCATGAGGATGGAGATGG + Intergenic
1004341749 6:14814080-14814102 TGGTTAAATGAGGCTGGAGAGGG - Intergenic
1004411521 6:15385665-15385687 TGTGTGAATGAGCATGCAGACGG + Intronic
1005287612 6:24345566-24345588 TGTATTCAAGAGGATTCAGAAGG + Intronic
1008202139 6:48603622-48603644 TGTAATAATGAGTATGGAACTGG - Intergenic
1008418009 6:51265748-51265770 TGTTTTAAGGAGGATGATGAGGG - Intergenic
1008856938 6:56099833-56099855 GGTATTAATAAGCATGGAGTGGG - Intronic
1011232732 6:85181004-85181026 TCTATTGCTGAGGAAGGAGAAGG - Intergenic
1011590331 6:88965095-88965117 TGTGGCAATGAGTATGGAGAGGG - Intergenic
1011726143 6:90212416-90212438 TGTAACTTTGAGGATGGAGAGGG - Intronic
1012326617 6:97927656-97927678 TGTTTTATTGAGGATTTAGATGG - Intergenic
1012367474 6:98460091-98460113 TGTTTTAATGAACATGGAAAGGG - Intergenic
1013692170 6:112658589-112658611 TGTGTTCATGAGGCTGGGGAGGG - Intergenic
1013718981 6:113000128-113000150 TTTAATAATGAGGAAGAAGAGGG + Intergenic
1013756204 6:113464640-113464662 TGAATTGATGGGGAAGGAGAGGG + Intergenic
1013924642 6:115455714-115455736 TCTATTAAGGAGGCTGCAGATGG + Intergenic
1014450908 6:121580404-121580426 TGTATTTTTGAGCAGGGAGATGG - Intergenic
1015379415 6:132549645-132549667 AGAATGAATGAGAATGGAGAAGG - Intergenic
1015840832 6:137475281-137475303 ATTATTAATGAGGATGGTGCAGG - Intergenic
1015926666 6:138317018-138317040 TTTATTAAAGGGGAAGGAGAAGG + Intronic
1015946921 6:138512436-138512458 TGTATTAACGAAGAAGAAGAGGG - Intronic
1015999815 6:139030534-139030556 TTTATTATTTAGGAAGGAGAGGG - Intronic
1016053228 6:139551893-139551915 TGTACTACTGAAGATGGAAAGGG + Intergenic
1016869522 6:148802983-148803005 TATATTATTGATGATGGTGATGG + Intronic
1016933301 6:149429633-149429655 TGCATTAGGGAGGATGGGGAGGG - Intergenic
1017503379 6:155045935-155045957 TGTTTTAATGAGGAAGAGGAGGG + Intronic
1017542604 6:155418151-155418173 TGTATGAATGGGGAGGGAGGGGG - Intronic
1018129202 6:160712355-160712377 TGAATTATTGGGGATGGAGGAGG - Intronic
1018362746 6:163087889-163087911 AGTGTTGGTGAGGATGGAGAGGG + Intronic
1018744189 6:166749787-166749809 GACATTAAGGAGGATGGAGATGG - Intronic
1019003491 6:168776695-168776717 TGTAATAATGACCATGAAGATGG + Intergenic
1020838614 7:13185733-13185755 TGTAGTAATGAAGAATGAGATGG - Intergenic
1022482784 7:30754675-30754697 TGGATGAATGTGGATGGACATGG - Intronic
1023186352 7:37537200-37537222 TGTATAGATGAGGATAGAAATGG - Intergenic
1023262539 7:38372615-38372637 TGTATCAATGAGGCTGGGCACGG + Intergenic
1023668378 7:42549983-42550005 TGTATAATTGAGTATGGAAATGG + Intergenic
1024064701 7:45722516-45722538 AGTATAAATGAGGATGGCGGAGG - Exonic
1024190069 7:46997106-46997128 TGGATTAATGAGGTTGTAGAAGG - Intergenic
1024632783 7:51263075-51263097 TGTATTAATGAGAATGTGGCTGG - Intronic
1026399405 7:69994074-69994096 TGTATTAATAAGGCTGGGCATGG + Intronic
1026520147 7:71110336-71110358 TGTAATCATCAGGAAGGAGATGG + Intergenic
1027178470 7:75920445-75920467 TGTAGTAATGAGGAGGAAGATGG + Intronic
1029942391 7:104494500-104494522 TTTATTAAAGATGATGAAGAAGG - Intronic
1030026476 7:105329290-105329312 TGTACTAATGTGGATGGATAAGG + Intronic
1031025326 7:116672795-116672817 TGTATGACTTAGGAGGGAGAGGG + Intronic
1032326729 7:130935968-130935990 TAAATAAATGAGGATGCAGATGG + Intergenic
1032728790 7:134617064-134617086 AGTATTGAGGAGAATGGAGAAGG + Intergenic
1033682869 7:143613093-143613115 AATGTTAATGAAGATGGAGAAGG - Intergenic
1033701742 7:143844549-143844571 AATGTTAATGAAGATGGAGAAGG + Intergenic
1036080685 8:5552433-5552455 TGTGTAAATGAGGAAGGACAGGG - Intergenic
1036103369 8:5812490-5812512 TGTATTAATGAAAATGAAGTTGG - Intergenic
1037224051 8:16562119-16562141 TGTATTACTGGGGATCTAGAAGG + Intronic
1037353483 8:17991643-17991665 AGGATTATTGAGGATGGAGATGG + Exonic
1037462821 8:19130488-19130510 TAAATTAATGAGGAAGGTGAAGG - Intergenic
1037620518 8:20559551-20559573 GGGATTGATGAGGAGGGAGAGGG + Intergenic
1038279520 8:26151337-26151359 TGTATTTTTGAGGATGGAGTTGG + Intergenic
1039354382 8:36799179-36799201 TGTATCAGTCAGGATGGGGAAGG - Intronic
1041740047 8:61148467-61148489 TGTATCAATGAGAGTGGGGAGGG - Intronic
1041845668 8:62325276-62325298 TGTAGCAATGTGGATGGAGCTGG - Intronic
1041963658 8:63649195-63649217 TGTCTTTCTGAGTATGGAGAGGG + Intergenic
1043774693 8:84251137-84251159 TGTATAAATGTAGATGGGGAAGG + Intronic
1043997301 8:86833936-86833958 TGTTTTCATGAGAATGCAGATGG - Intergenic
1044507339 8:93037504-93037526 GGTATCATTGAGGATAGAGAAGG + Intergenic
1046882428 8:119323946-119323968 TGTATTGATGATGATGTAAAGGG - Intergenic
1047663033 8:127059382-127059404 TGGATTAATGAATATGGACAGGG - Intergenic
1050268905 9:3920447-3920469 AATATTAATGAGGATAGAGACGG + Intronic
1055210961 9:73790709-73790731 TGTATAAATGAAGATGAAAAAGG + Intergenic
1055437108 9:76302770-76302792 TGTATGAAAAAGGGTGGAGAAGG + Intronic
1056641969 9:88379141-88379163 AGTATAAATGAGTATGGAGAGGG + Intergenic
1057766246 9:97922030-97922052 TGTAGGAATGAGGACAGAGAAGG - Intronic
1058197897 9:102001337-102001359 TGAGTTAATAATGATGGAGAGGG - Intergenic
1058750327 9:108032997-108033019 AGTTTTGATGAGGATGGAGAAGG - Intergenic
1058750352 9:108033189-108033211 AGTTTTGATGAGGATGGAGAAGG - Intergenic
1059060348 9:111029599-111029621 TGCATATCTGAGGATGGAGAGGG - Intronic
1059206110 9:112467577-112467599 TGAAATCATGAGGATGGAGCCGG - Intronic
1062072261 9:134562830-134562852 TGTATTATTGAGCAAGGAGAGGG + Intergenic
1185721228 X:2383322-2383344 TGTGATAATGATGATGGTGATGG - Intronic
1187428244 X:19197897-19197919 TGTATTAATCAGGATGGGCTAGG + Intergenic
1188387241 X:29576077-29576099 TTTATAAATGATGATGCAGAGGG - Intronic
1188961353 X:36496284-36496306 TGTATTAACATGGATGGAGCTGG + Intergenic
1188966569 X:36560847-36560869 TGTAGGAATGTGGATGGAGGTGG - Intergenic
1190010007 X:46776274-46776296 TGAATTAATGACAATGGAGATGG + Intergenic
1191923433 X:66281651-66281673 TGTATAAATGAGGACAGAGAAGG + Intergenic
1192291524 X:69801159-69801181 TGTATTTATGAGTTTGGAGTAGG + Intronic
1192315586 X:70048964-70048986 TGTATTAATCAGGATGGTCTAGG - Intronic
1193794671 X:85859046-85859068 TGCAGCAATGTGGATGGAGATGG + Intergenic
1195943421 X:110183621-110183643 TGTCTTGATGAGGATGATGATGG - Intergenic
1195977365 X:110542221-110542243 AGTATTAGGGAGGATGGAGAGGG - Intergenic
1196321890 X:114351032-114351054 TGTTTTAAAGAGGATACAGATGG + Intergenic
1196585170 X:117420178-117420200 TGTATTGATTAGGAAGGGGACGG - Intergenic
1197107783 X:122736279-122736301 TGTAGTAATGTGGATGGAACTGG + Intergenic
1198268990 X:135036330-135036352 TGACTTTATGATGATGGAGAAGG + Intergenic
1199218733 X:145292092-145292114 TAGATTAATGAGGAGGGAGTAGG - Intergenic
1199570547 X:149263087-149263109 TGAAGTCAGGAGGATGGAGAAGG - Intergenic
1199706622 X:150431705-150431727 TGCATAAATGTGGATGGAGCTGG - Intronic
1201906255 Y:19088401-19088423 GGTATTAATGATGATGATGACGG - Intergenic
1202581839 Y:26389930-26389952 TGTATTAATGAGCATGGGAGTGG - Intergenic