ID: 951227917

View in Genome Browser
Species Human (GRCh38)
Location 3:20142609-20142631
Sequence AGCACTTAACTCTCCACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951227917_951227920 7 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227920 3:20142639-20142661 GAGTGTTGACTCCAAGGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 207
951227917_951227919 2 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227919 3:20142634-20142656 TTTGTGAGTGTTGACTCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 150
951227917_951227918 1 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227918 3:20142633-20142655 CTTTGTGAGTGTTGACTCCAAGG 0: 1
1: 0
2: 0
3: 16
4: 127
951227917_951227921 11 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227921 3:20142643-20142665 GTTGACTCCAAGGGAAAGGTAGG 0: 1
1: 0
2: 2
3: 21
4: 152
951227917_951227925 22 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227925 3:20142654-20142676 GGGAAAGGTAGGATCTGTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 181
951227917_951227923 20 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227923 3:20142652-20142674 AAGGGAAAGGTAGGATCTGTAGG 0: 1
1: 0
2: 1
3: 19
4: 274
951227917_951227924 21 Left 951227917 3:20142609-20142631 CCAAGAGTGGAGAGTTAAGTGCT 0: 1
1: 0
2: 0
3: 9
4: 132
Right 951227924 3:20142653-20142675 AGGGAAAGGTAGGATCTGTAGGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951227917 Original CRISPR AGCACTTAACTCTCCACTCT TGG (reversed) Intronic