ID: 951228986

View in Genome Browser
Species Human (GRCh38)
Location 3:20155005-20155027
Sequence GCAGCTGGTCAATCACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951228986 Original CRISPR GCAGCTGGTCAATCACATTC TGG (reversed) Intergenic
910632048 1:89365203-89365225 ACAGCTGTTCAATCCTATTCAGG - Intronic
913975065 1:143449526-143449548 GCAGCTGGGCAAACACCTTCCGG + Intergenic
914069457 1:144275142-144275164 GCAGCTGGGCAAACACCTTCCGG + Intergenic
914109698 1:144691212-144691234 GCAGCTGGGCAAACACCTTCCGG - Intergenic
915679997 1:157572211-157572233 GCAGCACCTCAACCACATTCAGG + Intergenic
917807094 1:178623793-178623815 GCAGCTGGTCAATGGTATGCTGG - Intergenic
1066654726 10:37687072-37687094 GCAGGTGGTCAAACACTGTCAGG + Intergenic
1072490968 10:95905885-95905907 GCAGCTGGTAAATAACAGTGAGG + Intronic
1087936749 11:104043229-104043251 GCAGGTGGTCAATAAAATTCTGG - Intronic
1092155599 12:6279717-6279739 TCTGCTGGGCACTCACATTCAGG - Intergenic
1093843056 12:23929428-23929450 TCAGCTAGCCAATTACATTCAGG + Intronic
1095887695 12:47206121-47206143 TCAGCTGATCCATCACATGCAGG + Intronic
1098765431 12:74482596-74482618 GCAGCTGGTGATCCACAGTCAGG - Intergenic
1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG + Intronic
1104933042 12:132350423-132350445 GCAGCTTTTCAATGACATTTTGG - Intergenic
1106631145 13:31475050-31475072 GCACTTGGTCAATCACACACAGG - Intergenic
1107810732 13:44197469-44197491 GCAGCTGGGCAAGCAAAATCTGG + Intergenic
1109362789 13:61318333-61318355 GCACCTGGTTAATGACATTATGG - Intergenic
1111395373 13:87661296-87661318 GCAGCTGGTACATAACATTTAGG - Intergenic
1122922112 14:104884531-104884553 GCACCTGGTCGATCATCTTCCGG - Exonic
1125922633 15:43534637-43534659 GCAGCTGATCAATCACTTCAGGG + Exonic
1128931744 15:71710503-71710525 GCACTGGGTCAACCACATTCTGG - Intronic
1134515045 16:14880178-14880200 TGGGCTGGTGAATCACATTCAGG + Intronic
1134702722 16:16278825-16278847 TGGGCTGGTGAATCACATTCAGG + Intronic
1134964821 16:18433290-18433312 TGGGCTGGTGAATCACATTCAGG - Intronic
1134969108 16:18515825-18515847 TGGGCTGGTGAATCACATTCAGG - Intronic
1141284889 16:82662508-82662530 CCATCTGGTCAATCTCACTCAGG - Intronic
1144329254 17:14209642-14209664 CCAGCAGGTCAATTACATTTGGG - Intergenic
1144342214 17:14319228-14319250 GCAGCTTGTCAATTACATTCTGG + Intronic
1147692618 17:42326172-42326194 GCAGCTCCTCAGTCACAATCAGG + Exonic
1147769474 17:42857549-42857571 GGGGCTGTCCAATCACATTCAGG + Exonic
1152448414 17:80360529-80360551 TCAGCTGGTCATTCCCATTCTGG + Intronic
1157674458 18:49558812-49558834 GCAGCTGCTCAATAAGCTTCTGG + Intergenic
1159881089 18:73859162-73859184 GCAGCTGTTCACTCCCATCCTGG - Intergenic
1166901706 19:46068823-46068845 GCCTCAGGGCAATCACATTCGGG + Intronic
1168339277 19:55614329-55614351 GCACCTGGTCCAGCACATGCTGG + Exonic
926197167 2:10771076-10771098 GCAGCTGGTCAGTGATGTTCAGG + Intronic
927757603 2:25721805-25721827 GCAGCAGGGCAATCAGATTTTGG + Intergenic
927857640 2:26537371-26537393 TCAGCTGGTGGCTCACATTCAGG + Intronic
931597395 2:63963844-63963866 GCAGCATATAAATCACATTCTGG - Intronic
932629994 2:73332713-73332735 ACAGCTGGTCTGTAACATTCTGG - Intergenic
934290059 2:91684760-91684782 GCAGCTGGGCAAACACCTTCCGG + Intergenic
942369842 2:175272011-175272033 CCACCTGGTCAATCACATACGGG - Intergenic
946983267 2:225242726-225242748 TCATCTCTTCAATCACATTCTGG + Intergenic
947388049 2:229611999-229612021 GCAGCTGATCAATCACAGCGTGG + Intronic
1175795027 20:61765932-61765954 CCAGCTGGCCAATCAGAGTCCGG - Intronic
1176931000 21:14810062-14810084 CCAGCTGATCTATCACATGCAGG - Intergenic
1180077917 21:45472568-45472590 GCAGCTGAGCCTTCACATTCAGG - Intronic
1182296281 22:29312487-29312509 TGAGCTGGTCCATCACATCCAGG - Exonic
1184786105 22:46672707-46672729 GCAGCTGGACTCTCACATCCAGG + Intronic
950401177 3:12769927-12769949 ACAGCTGGTAAGTCACAGTCAGG - Intergenic
951228986 3:20155005-20155027 GCAGCTGGTCAATCACATTCTGG - Intergenic
953420931 3:42752589-42752611 GCAGCTGACCAATCGCATCCAGG - Exonic
954747870 3:52797246-52797268 GCAACTGGTCAAACACTTTGAGG + Exonic
954753507 3:52826790-52826812 GCAGCTGGTCAAGCACCTGCAGG - Exonic
956575061 3:70743497-70743519 GCAGCAGGTGAATCATCTTCAGG + Intergenic
956851121 3:73229135-73229157 GCAGCTGATCAATGACAATATGG - Intergenic
957716086 3:83930788-83930810 CCAGCTGGTCCATCAATTTCAGG + Intergenic
958772106 3:98437355-98437377 GCAGCTGGTGAGGGACATTCTGG + Intergenic
959373438 3:105558443-105558465 GCAGCCAGTAAATCACAATCTGG - Intronic
961186132 3:124916852-124916874 GCAGCTGTTAAATCTCAGTCTGG + Intronic
962267631 3:133955056-133955078 GCAGCTGGGCAACCACCATCAGG + Exonic
964374616 3:156036879-156036901 GCAGCTGGGCTTTCTCATTCAGG + Intergenic
969226594 4:5802595-5802617 GCAGCTAGACAATCACATCTGGG + Intronic
970169493 4:13275581-13275603 GCAGCTGGGGCATCACATTTAGG - Intergenic
973672236 4:53232516-53232538 ACAGCTGGGCAATTACATACTGG - Intronic
975922781 4:79412900-79412922 ACAGCTGGTCCAGCACATTTGGG - Intergenic
978939389 4:114418377-114418399 CCAGCTGCTTAATCACATTTTGG - Intergenic
988342777 5:29995923-29995945 ACAGCTGGTCTTTCAAATTCAGG + Intergenic
991572883 5:68074223-68074245 GCATCAGGCCAATCACATACAGG + Intergenic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
996855584 5:128002631-128002653 GCAGCTGGTGAAGCACAACCTGG - Intergenic
997371409 5:133363528-133363550 GCGGCTGGCCATTCAAATTCAGG - Intronic
1000287994 5:159844442-159844464 GCAGGTGGTAAATCACAGTGTGG + Intergenic
1004131680 6:12926666-12926688 GCAGCTTCTCCATCACAATCTGG + Intronic
1005397606 6:25399308-25399330 GCAGGTAGACAACCACATTCTGG - Intronic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1007075286 6:39062282-39062304 GGAGCTGGTAAATCACAGCCAGG - Intronic
1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG + Intergenic
1014514430 6:122363167-122363189 GCCCCTGGTCAATCACTTGCAGG - Intergenic
1014945351 6:127491002-127491024 TCAGCAAGTCAATCACAATCAGG - Intronic
1015199776 6:130566034-130566056 GCATCTTGTCAATTACGTTCAGG - Intergenic
1018074413 6:160198808-160198830 GCAGCTGGTGGATAACATTCTGG + Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1024428052 7:49251903-49251925 GTAGGTGGTCAATCAGATTATGG + Intergenic
1027249304 7:76389189-76389211 TCAGCAGGTCCATCACATCCTGG - Intergenic
1028357107 7:89923891-89923913 GAAGATGATCAATCACATTTTGG - Intergenic
1032932386 7:136688682-136688704 GCACCTGGTCACTCACAGCCTGG + Intergenic
1041196353 8:55405470-55405492 GCAGCAGGTCAATCACCTCTTGG + Intronic
1041523693 8:58782472-58782494 GAAACTGGCCATTCACATTCTGG - Intergenic
1043247264 8:78020583-78020605 CCACCTGGGCAATAACATTCTGG - Intergenic
1048303996 8:133270949-133270971 GCAGCTTGCAAAACACATTCAGG - Intronic
1050188656 9:3001815-3001837 GCAGATGGTTAACCACATACAGG - Intergenic
1055060690 9:72065802-72065824 CCAGCTGGTCAAGTAAATTCAGG - Intronic
1188584705 X:31759051-31759073 GCAGGTTGTCAATAACATACAGG + Intronic
1189774402 X:44457284-44457306 GCAACTGGTTAATTACATTGTGG + Intergenic
1192772187 X:74204464-74204486 GCAGCTGGATAAGCTCATTCTGG - Intergenic
1196937458 X:120743741-120743763 GTAGATGGTTAATCACATGCCGG - Intergenic
1198466045 X:136905760-136905782 GCAACTGGTCAATCTCTTCCAGG + Intergenic