ID: 951229194

View in Genome Browser
Species Human (GRCh38)
Location 3:20157293-20157315
Sequence TGTTAACAGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951229194_951229198 18 Left 951229194 3:20157293-20157315 CCTGCCATCTTCTGCTGTTAACA No data
Right 951229198 3:20157334-20157356 ACTTAAAAACATCTGTGAATGGG No data
951229194_951229197 17 Left 951229194 3:20157293-20157315 CCTGCCATCTTCTGCTGTTAACA No data
Right 951229197 3:20157333-20157355 TACTTAAAAACATCTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951229194 Original CRISPR TGTTAACAGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr