ID: 951233668

View in Genome Browser
Species Human (GRCh38)
Location 3:20209814-20209836
Sequence GCCCTTCAGGACTATGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951233662_951233668 30 Left 951233662 3:20209761-20209783 CCTGCCATCCTCTGTGTGATTAT No data
Right 951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG No data
951233663_951233668 26 Left 951233663 3:20209765-20209787 CCATCCTCTGTGTGATTATTTCA No data
Right 951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG No data
951233664_951233668 22 Left 951233664 3:20209769-20209791 CCTCTGTGTGATTATTTCATTGA No data
Right 951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951233668 Original CRISPR GCCCTTCAGGACTATGTTGA TGG Intergenic
No off target data available for this crispr