ID: 951243892

View in Genome Browser
Species Human (GRCh38)
Location 3:20317747-20317769
Sequence CAACCTACGGGGAAATGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951243892_951243901 21 Left 951243892 3:20317747-20317769 CCCCCTCATTTCCCCGTAGGTTG No data
Right 951243901 3:20317791-20317813 CTTTGAACTATGCTTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951243892 Original CRISPR CAACCTACGGGGAAATGAGG GGG (reversed) Intergenic
No off target data available for this crispr