ID: 951244900

View in Genome Browser
Species Human (GRCh38)
Location 3:20329883-20329905
Sequence ACCTACATTTCACCTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951244899_951244900 27 Left 951244899 3:20329833-20329855 CCAATTGAAAATAAAAATGAATA No data
Right 951244900 3:20329883-20329905 ACCTACATTTCACCTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951244900 Original CRISPR ACCTACATTTCACCTAGAGT AGG Intergenic
No off target data available for this crispr