ID: 951246683

View in Genome Browser
Species Human (GRCh38)
Location 3:20349575-20349597
Sequence CAATACATGCAGAAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951246676_951246683 20 Left 951246676 3:20349532-20349554 CCCACTTCTGATCTGTCAGAAAA No data
Right 951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG No data
951246677_951246683 19 Left 951246677 3:20349533-20349555 CCACTTCTGATCTGTCAGAAAAT No data
Right 951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG No data
951246679_951246683 -4 Left 951246679 3:20349556-20349578 CCTGTTGGATCCACCTTCACAAT No data
Right 951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951246683 Original CRISPR CAATACATGCAGAAGCTGGA TGG Intergenic
No off target data available for this crispr