ID: 951249298

View in Genome Browser
Species Human (GRCh38)
Location 3:20375606-20375628
Sequence CTGTTTCACAATCAGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
951249298_951249301 -5 Left 951249298 3:20375606-20375628 CCCCAGGGCTGATTGTGAAACAG No data
Right 951249301 3:20375624-20375646 AACAGTTACCAGCACATCACTGG No data
951249298_951249303 11 Left 951249298 3:20375606-20375628 CCCCAGGGCTGATTGTGAAACAG No data
Right 951249303 3:20375640-20375662 TCACTGGCTGTATACACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
951249298 Original CRISPR CTGTTTCACAATCAGCCCTG GGG (reversed) Intergenic
No off target data available for this crispr